ID: 1166173863

View in Genome Browser
Species Human (GRCh38)
Location 19:41051584-41051606
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166173858_1166173863 -3 Left 1166173858 19:41051564-41051586 CCTGCAAACTATGAATGCTTTTG No data
Right 1166173863 19:41051584-41051606 TTGGCATTTTAAAATGGTTGGGG No data
1166173856_1166173863 20 Left 1166173856 19:41051541-41051563 CCCTGCTGCTTGTGTTCATACAG No data
Right 1166173863 19:41051584-41051606 TTGGCATTTTAAAATGGTTGGGG No data
1166173857_1166173863 19 Left 1166173857 19:41051542-41051564 CCTGCTGCTTGTGTTCATACAGC No data
Right 1166173863 19:41051584-41051606 TTGGCATTTTAAAATGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166173863 Original CRISPR TTGGCATTTTAAAATGGTTG GGG Intergenic
No off target data available for this crispr