ID: 1166176787

View in Genome Browser
Species Human (GRCh38)
Location 19:41078875-41078897
Sequence CACTCAGTTTAAATGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166176787_1166176792 4 Left 1166176787 19:41078875-41078897 CCAGATCTCATTTAAACTGAGTG No data
Right 1166176792 19:41078902-41078924 CCCACTCATCACCAAGGGGATGG No data
1166176787_1166176795 23 Left 1166176787 19:41078875-41078897 CCAGATCTCATTTAAACTGAGTG No data
Right 1166176795 19:41078921-41078943 ATGGCACTAAGCCATTCATGAGG 0: 58
1: 255
2: 820
3: 1635
4: 2231
1166176787_1166176788 -2 Left 1166176787 19:41078875-41078897 CCAGATCTCATTTAAACTGAGTG No data
Right 1166176788 19:41078896-41078918 TGAGAACCCACTCATCACCAAGG No data
1166176787_1166176796 24 Left 1166176787 19:41078875-41078897 CCAGATCTCATTTAAACTGAGTG No data
Right 1166176796 19:41078922-41078944 TGGCACTAAGCCATTCATGAGGG 0: 58
1: 290
2: 860
3: 1770
4: 2444
1166176787_1166176789 -1 Left 1166176787 19:41078875-41078897 CCAGATCTCATTTAAACTGAGTG No data
Right 1166176789 19:41078897-41078919 GAGAACCCACTCATCACCAAGGG No data
1166176787_1166176790 0 Left 1166176787 19:41078875-41078897 CCAGATCTCATTTAAACTGAGTG No data
Right 1166176790 19:41078898-41078920 AGAACCCACTCATCACCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166176787 Original CRISPR CACTCAGTTTAAATGAGATC TGG (reversed) Intergenic
No off target data available for this crispr