ID: 1166176789

View in Genome Browser
Species Human (GRCh38)
Location 19:41078897-41078919
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166176785_1166176789 18 Left 1166176785 19:41078856-41078878 CCCAGGCTCTTTTAAACAACCAG 0: 9
1: 61
2: 157
3: 180
4: 328
Right 1166176789 19:41078897-41078919 GAGAACCCACTCATCACCAAGGG No data
1166176786_1166176789 17 Left 1166176786 19:41078857-41078879 CCAGGCTCTTTTAAACAACCAGA 0: 37
1: 231
2: 758
3: 1848
4: 2378
Right 1166176789 19:41078897-41078919 GAGAACCCACTCATCACCAAGGG No data
1166176787_1166176789 -1 Left 1166176787 19:41078875-41078897 CCAGATCTCATTTAAACTGAGTG No data
Right 1166176789 19:41078897-41078919 GAGAACCCACTCATCACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166176789 Original CRISPR GAGAACCCACTCATCACCAA GGG Intergenic
No off target data available for this crispr