ID: 1166176795

View in Genome Browser
Species Human (GRCh38)
Location 19:41078921-41078943
Sequence ATGGCACTAAGCCATTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4999
Summary {0: 58, 1: 255, 2: 820, 3: 1635, 4: 2231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166176791_1166176795 -4 Left 1166176791 19:41078902-41078924 CCCACTCATCACCAAGGGGATGG 0: 6
1: 17
2: 13
3: 36
4: 136
Right 1166176795 19:41078921-41078943 ATGGCACTAAGCCATTCATGAGG 0: 58
1: 255
2: 820
3: 1635
4: 2231
1166176787_1166176795 23 Left 1166176787 19:41078875-41078897 CCAGATCTCATTTAAACTGAGTG No data
Right 1166176795 19:41078921-41078943 ATGGCACTAAGCCATTCATGAGG 0: 58
1: 255
2: 820
3: 1635
4: 2231
1166176793_1166176795 -5 Left 1166176793 19:41078903-41078925 CCACTCATCACCAAGGGGATGGC No data
Right 1166176795 19:41078921-41078943 ATGGCACTAAGCCATTCATGAGG 0: 58
1: 255
2: 820
3: 1635
4: 2231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166176795 Original CRISPR ATGGCACTAAGCCATTCATG AGG Intergenic
Too many off-targets to display for this crispr