ID: 1166176796

View in Genome Browser
Species Human (GRCh38)
Location 19:41078922-41078944
Sequence TGGCACTAAGCCATTCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5422
Summary {0: 58, 1: 290, 2: 860, 3: 1770, 4: 2444}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166176791_1166176796 -3 Left 1166176791 19:41078902-41078924 CCCACTCATCACCAAGGGGATGG 0: 6
1: 17
2: 13
3: 36
4: 136
Right 1166176796 19:41078922-41078944 TGGCACTAAGCCATTCATGAGGG 0: 58
1: 290
2: 860
3: 1770
4: 2444
1166176793_1166176796 -4 Left 1166176793 19:41078903-41078925 CCACTCATCACCAAGGGGATGGC No data
Right 1166176796 19:41078922-41078944 TGGCACTAAGCCATTCATGAGGG 0: 58
1: 290
2: 860
3: 1770
4: 2444
1166176787_1166176796 24 Left 1166176787 19:41078875-41078897 CCAGATCTCATTTAAACTGAGTG No data
Right 1166176796 19:41078922-41078944 TGGCACTAAGCCATTCATGAGGG 0: 58
1: 290
2: 860
3: 1770
4: 2444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166176796 Original CRISPR TGGCACTAAGCCATTCATGA GGG Intergenic
Too many off-targets to display for this crispr