ID: 1166177756

View in Genome Browser
Species Human (GRCh38)
Location 19:41086906-41086928
Sequence CAGGGAGTAAGTGAGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1039
Summary {0: 3, 1: 2, 2: 6, 3: 86, 4: 942}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166177756_1166177761 -4 Left 1166177756 19:41086906-41086928 CCAGCTCCCTCACTTACTCCCTG 0: 3
1: 2
2: 6
3: 86
4: 942
Right 1166177761 19:41086925-41086947 CCTGTGTGACCTCACTCAAGAGG 0: 4
1: 0
2: 3
3: 12
4: 163
1166177756_1166177762 4 Left 1166177756 19:41086906-41086928 CCAGCTCCCTCACTTACTCCCTG 0: 3
1: 2
2: 6
3: 86
4: 942
Right 1166177762 19:41086933-41086955 ACCTCACTCAAGAGGATTTATGG 0: 3
1: 1
2: 0
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166177756 Original CRISPR CAGGGAGTAAGTGAGGGAGC TGG (reversed) Intergenic
900206536 1:1434158-1434180 CAGGTAGTCAGGCAGGGAGCTGG - Intergenic
900339846 1:2182875-2182897 CAGTGAATGAGTGAGTGAGCAGG + Intronic
900689675 1:3972990-3973012 CACAGAGTAAGTGGGAGAGCTGG + Intergenic
900990853 1:6097600-6097622 CAGAGATAAAGGGAGGGAGCTGG + Intronic
901389926 1:8938278-8938300 AAAGGAGGAAGTGAGGGAGGGGG + Intergenic
901760868 1:11470497-11470519 CAGCTAGTAAGCGACGGAGCTGG + Intergenic
901934454 1:12618064-12618086 CAGAGAGGGAGGGAGGGAGCCGG - Intergenic
901938822 1:12646250-12646272 CAGCGAGTGAGTGACAGAGCTGG - Intronic
901977839 1:13009487-13009509 CAGGGAGGAAGTGATGAGGCAGG + Intronic
902004247 1:13219449-13219471 CAGGGAGGAAGTGATGAGGCAGG - Intergenic
902023470 1:13365184-13365206 CAGGGAGGAAGTGATGAGGCAGG - Intergenic
902130515 1:14256432-14256454 AAGGGAGAAAGTGAGGCAGAGGG + Intergenic
902131328 1:14263618-14263640 AAGGGAAAAAGTGTGGGAGCGGG + Intergenic
902253135 1:15169160-15169182 CAGCTAGAAAGTGAGGGAGTCGG + Intronic
902259018 1:15210040-15210062 AAGGGAGGAAGGGAGGGAGACGG + Intronic
902410764 1:16210273-16210295 CAGGGAGGGAGGGAGGGAGCAGG + Intronic
902543804 1:17173506-17173528 CAGGGAGGAAGTAGTGGAGCAGG - Intergenic
902612989 1:17608033-17608055 GAGGGAGGGAGGGAGGGAGCTGG + Intronic
902615353 1:17620655-17620677 GAGGGAGTAGGGCAGGGAGCCGG + Intronic
902677753 1:18020693-18020715 GAGGGAGAAAGAGAGGGAGAGGG - Intergenic
902775079 1:18669464-18669486 ACGGCAGTCAGTGAGGGAGCTGG - Intronic
903140065 1:21334043-21334065 CTGGGACTAAGTGACAGAGCTGG + Intronic
903173115 1:21565654-21565676 CAGGGAGTGAGTGAGGACGGAGG + Intronic
903255947 1:22099935-22099957 GAGCTAGTAAGTGAGGGAACTGG + Intergenic
903681980 1:25103314-25103336 CAGGGAGTGGGAGAGGGAGCTGG + Intergenic
903710043 1:25316693-25316715 CAGCTAGTAAGTGACAGAGCTGG + Intronic
903717073 1:25375713-25375735 CAGCTAGTAAGTGACAGAGCTGG - Intronic
903893633 1:26587501-26587523 CAGGTAGTAAGAGACAGAGCTGG + Intergenic
903907215 1:26695958-26695980 CGGGGAGGGAGGGAGGGAGCGGG - Intergenic
904259628 1:29280966-29280988 CAGCTAGTAAGTGGTGGAGCTGG + Intronic
904308185 1:29604169-29604191 AAGGGTGGAAGGGAGGGAGCAGG - Intergenic
904321082 1:29698207-29698229 CAGGGAGGGAGTGGAGGAGCAGG + Intergenic
904321088 1:29698226-29698248 CAGGGAGGGAGTGGAGGAGCAGG + Intergenic
904470822 1:30735127-30735149 CAGGGAGTTAGTGACAGGGCTGG + Intronic
904599518 1:31665834-31665856 CAGGGAGGCAGGGAAGGAGCTGG - Intronic
904865984 1:33579341-33579363 CAGCTAGTAGGTGAGAGAGCTGG + Intronic
905329035 1:37179252-37179274 CCTGGAGTAAGAGAGAGAGCTGG + Intergenic
905507057 1:38488493-38488515 CAGCTAGGAAGTGATGGAGCTGG - Intergenic
905515701 1:38560295-38560317 CAGGTAGTGAGTGACAGAGCTGG - Intergenic
905801190 1:40844060-40844082 GAGGGAGTAAGTGTGGGTGTGGG + Intergenic
906196112 1:43931787-43931809 CAGGCAGTAAGTGGGGTGGCCGG + Intergenic
906240700 1:44240529-44240551 CAGCAAGGAAGTGAGAGAGCAGG - Intronic
906403781 1:45525164-45525186 AAGGGAGTTAGTGAGGGAGCTGG - Intergenic
906465050 1:46071101-46071123 AAGGGAGAGAGTGAGGGAGAAGG - Intronic
906785249 1:48609989-48610011 CAGCTAGTAAGTGGGGGAACAGG - Intronic
906787929 1:48632130-48632152 GAGGAAGGAACTGAGGGAGCGGG + Intronic
907140397 1:52181064-52181086 GAGGGAGAAAGTGAGGGAGAGGG - Intronic
907197578 1:52699114-52699136 CACACAGTAAGTGAGGGAGTTGG + Intergenic
907310539 1:53536592-53536614 CAGCCAGTCAGTGACGGAGCAGG + Intronic
907325561 1:53636730-53636752 GAGTGACTGAGTGAGGGAGCAGG - Intronic
907666138 1:56435279-56435301 CAGCAAGGAAGTCAGGGAGCTGG - Intergenic
907736037 1:57113138-57113160 CAGGTGGTAAGTGACAGAGCTGG - Intronic
907745177 1:57206225-57206247 CAGGGAGAAAAGGAGGGAGAGGG + Intronic
907861687 1:58359883-58359905 CAAAGAGTAAGTGATGAAGCAGG - Intronic
908323959 1:63005374-63005396 CAGCTAGTAAGTGAGTGAGCTGG + Intergenic
908358349 1:63344072-63344094 GAGGGAGGAAGGGAGGGAGGGGG - Intergenic
909640145 1:77863297-77863319 CAGGGAGGAAAGGAGTGAGCAGG - Intronic
910056051 1:83034025-83034047 GAGGGTGTAAGAGAGAGAGCTGG + Intergenic
910387416 1:86700566-86700588 CTGGGAGAGAGTGAGGGAGCTGG + Intergenic
910572342 1:88719974-88719996 CAAGTAGTAAGTGATAGAGCTGG + Intronic
912739024 1:112176169-112176191 CAACTAGTAAGTGAGAGAGCTGG + Intergenic
913241096 1:116830134-116830156 CAGTGAGTAAGTGGCAGAGCTGG - Intergenic
914449123 1:147774976-147774998 CAGCTAGTAAGTGGCGGAGCCGG - Intergenic
914665852 1:149832135-149832157 AAGGGAGGACGGGAGGGAGCAGG - Intergenic
914669913 1:149861659-149861681 AAGGGAGGACGGGAGGGAGCAGG + Intronic
915133689 1:153714436-153714458 GAGGGAGGGAGGGAGGGAGCCGG - Intergenic
915166991 1:153953462-153953484 CAGGGTGGGGGTGAGGGAGCAGG + Intronic
915213311 1:154325514-154325536 CGGGGCGGAAGTGACGGAGCCGG - Intergenic
915681152 1:157583093-157583115 CAGTGAGTAAGTTGAGGAGCTGG - Intronic
915932345 1:160068457-160068479 AAGGGAGGAAGGGAGGGAGAGGG - Intronic
916058759 1:161085139-161085161 TGGGGGGTAAGTGAGGGAGGTGG - Intronic
916074984 1:161195478-161195500 CAGGAAGTCAGTGATGAAGCGGG + Exonic
916272419 1:162957682-162957704 CAGTGGGCAAGGGAGGGAGCTGG - Intergenic
916301862 1:163284753-163284775 GAGGGACAAAGAGAGGGAGCTGG - Intronic
917236627 1:172899603-172899625 AGGGGAGTCAGTGAGGGACCTGG - Intergenic
917541304 1:175917162-175917184 GAGGGATAAAGTGAGGCAGCAGG + Intergenic
917631171 1:176893003-176893025 CAGGGAGAAAGGGAAGGGGCTGG + Intronic
917651759 1:177084635-177084657 GAGGTAGCAAGTGAGGGAGGGGG - Intronic
917719209 1:177770047-177770069 CAAAGAGTAAGGGAGGGAACAGG + Intergenic
917958889 1:180126932-180126954 CAGCTAGTAAGTGGTGGAGCTGG + Intergenic
919787665 1:201270115-201270137 CAGGGATTCAGTGATGGGGCAGG + Intergenic
919913814 1:202128126-202128148 CAGGGAGGAAGTCAGAGTGCAGG + Exonic
919922372 1:202174251-202174273 CAGGGAGGAAGCGGGGCAGCAGG + Intergenic
919981752 1:202646241-202646263 CAAGGAGACAGTGAGGGAGTGGG - Intronic
920096878 1:203492166-203492188 CAGGGAGGGAGAGTGGGAGCAGG + Intergenic
920867173 1:209762756-209762778 CAGGGAGGAAGTGAGGGAAGTGG - Intronic
921109689 1:212022890-212022912 TAGGGAGGAAGGGAGGGAGAGGG - Intronic
921600575 1:217102273-217102295 CAGCAAGTAAGTGTGGGATCTGG + Intronic
921828412 1:219700099-219700121 CAGGGAGTAAGGGGAGAAGCGGG + Intronic
921978865 1:221233385-221233407 AAGGGAGGAAGGGAGGGAGAAGG - Intergenic
922434289 1:225588177-225588199 CAGGAAGAAAGAGAGGGAGGAGG + Intronic
922723229 1:227909649-227909671 GAGGGAGTAAGGGAGGAAGGAGG + Intergenic
923455793 1:234164256-234164278 GAGGGAGTAAGGGAGGGAGATGG - Intronic
924015011 1:239711669-239711691 CAGAGAGAGAGTGAGAGAGCGGG - Intronic
924101167 1:240604048-240604070 CACACAGTAAGAGAGGGAGCAGG + Intronic
924212087 1:241780237-241780259 CAAGAAGTAAGTGAGGGAGAGGG + Intronic
924486427 1:244487772-244487794 CAGGGAGGCAGAGAGGCAGCAGG + Intronic
924581852 1:245330426-245330448 GAGGGAGTGGGGGAGGGAGCGGG + Intronic
1063114243 10:3063064-3063086 GAAGGAGTAAGTGAGTGAGTGGG - Intergenic
1063767485 10:9159524-9159546 AAGGAAGCAAGAGAGGGAGCAGG - Intergenic
1065856948 10:29838827-29838849 CAGGAAGGAAGGGAGGGAGAGGG + Intergenic
1066596193 10:37052578-37052600 GAGGGAGAAAGGGAGGGAGGAGG + Intergenic
1067242416 10:44507960-44507982 CAGGGAAGAAGCGAGAGAGCAGG - Intergenic
1067750509 10:48968430-48968452 CCAGGAGGAAGAGAGGGAGCAGG - Intronic
1067908638 10:50320903-50320925 CAGGGAGTCAGAGGGGGATCTGG + Intronic
1067965568 10:50909084-50909106 GAGGGAGGAAGAGAGGGAGCTGG - Intergenic
1068860775 10:61845770-61845792 CAGAGAGTAACTGAAGCAGCAGG + Intergenic
1069946122 10:71986986-71987008 CAGAGAGTAAGTGGGAGAGCTGG + Intronic
1070391307 10:75973247-75973269 CAGCAAGTAAGTGACAGAGCTGG + Intronic
1070554439 10:77516942-77516964 GAGGGAGGAAGTGAGGGTGAGGG + Intronic
1070729868 10:78819170-78819192 CAGCGAGTAAGTGGCAGAGCTGG - Intergenic
1070768272 10:79068603-79068625 CAGGGAGTAGCGGAGGGAGTAGG + Intergenic
1070831634 10:79421436-79421458 GAGGGAGGAAGGGAGGGAGGGGG - Intronic
1070874060 10:79784708-79784730 CAGGGACTGAGAGAGGGAACAGG - Intergenic
1071640992 10:87306847-87306869 CAGGGACTGAGAGAGGGAACAGG - Intergenic
1071654244 10:87431089-87431111 CAGGGACTGAGAGAGGGAACAGG + Intergenic
1072199552 10:93145894-93145916 CAGGGAGCTGGTGAGAGAGCTGG - Intergenic
1072237373 10:93465181-93465203 CAGCTAGTAAGTGATGGAGCTGG + Intronic
1072682330 10:97516402-97516424 CAGGCAGCCAGTGAGGGGGCTGG + Intronic
1072754739 10:98011786-98011808 GAGGGAGGAAGGGAGGGAGATGG + Intronic
1072805082 10:98419004-98419026 GAGGCTGTAAGTGAGGAAGCCGG - Intronic
1072863527 10:99032443-99032465 CAGGGAGTAAGTGGGGATCCTGG - Intronic
1073009025 10:100346120-100346142 CAACCAGTAAGTGATGGAGCTGG - Intergenic
1073546540 10:104354024-104354046 GCGGGAGTGAGTGAGGGTGCAGG - Intronic
1073615658 10:104992132-104992154 TAGGGTGTAGGGGAGGGAGCAGG + Intronic
1073680089 10:105693819-105693841 AAGGGAGCAAGGGAGGGAGGCGG - Intergenic
1073974689 10:109087280-109087302 CAGGGAGAAATTGAGGGAAGGGG - Intergenic
1074440067 10:113470491-113470513 CAGGGAGGATGTGGGGAAGCAGG + Intergenic
1074577710 10:114686070-114686092 CAGGGGCAAAGTGGGGGAGCAGG + Intergenic
1075741170 10:124697464-124697486 TGGGGATGAAGTGAGGGAGCTGG - Intronic
1076038003 10:127217032-127217054 CAGAGAGGAAGAGAGGGAGAGGG + Intronic
1076273195 10:129174564-129174586 CAGGGATCAAATGAGGGAGGAGG + Intergenic
1076510094 10:131007206-131007228 CAGCTAGTATGTGACGGAGCTGG + Intergenic
1076836916 10:133025789-133025811 GCGGGAGCAAGTGTGGGAGCTGG + Intergenic
1077200622 11:1305711-1305733 CAGGGAGGAAGGGAGGGGCCAGG + Intronic
1077246529 11:1541992-1542014 TGGGGATTAAGTGAGGGAGCAGG - Intergenic
1077251026 11:1560792-1560814 CAGGGAGGAGGAGAGGCAGCAGG - Intronic
1077258305 11:1599724-1599746 GAGGGAGGAAGGGAGGGAGGGGG + Intergenic
1077630944 11:3810644-3810666 CTGGGGGCACGTGAGGGAGCAGG + Intronic
1077988127 11:7375917-7375939 CCTGAAGGAAGTGAGGGAGCAGG - Intronic
1078410545 11:11112895-11112917 TAGCTAGTAAGTGATGGAGCTGG + Intergenic
1078425103 11:11243501-11243523 CTGGCAGTAAGTGGTGGAGCAGG - Intergenic
1078476209 11:11632613-11632635 CAGGGAGGAGCTGGGGGAGCTGG + Intergenic
1078618051 11:12883021-12883043 CAGGCAGGGACTGAGGGAGCTGG - Exonic
1078968335 11:16373893-16373915 GAGGGAGGAAGGGAGGGAGAAGG + Intronic
1079166932 11:18053043-18053065 CAAGGAGTAAGGGTGGAAGCAGG + Intergenic
1079957195 11:26880186-26880208 GAGGGAGTAAGAGAGGGAGAAGG + Intergenic
1080022412 11:27576739-27576761 CAGGGAGGGAGGGAGGGAGACGG - Intergenic
1080261180 11:30351372-30351394 TAGCTAGTAAGTGATGGAGCCGG - Intergenic
1081600384 11:44488602-44488624 GAGGGAGGGAGGGAGGGAGCGGG - Intergenic
1081646327 11:44793003-44793025 CAGGGGGAAGGGGAGGGAGCTGG + Intronic
1081975769 11:47233785-47233807 GAGGAATTAAGTGAGGGTGCTGG + Intronic
1082185832 11:49180127-49180149 CAGAGAGTAAGTGAGAGAGCCGG - Intronic
1082240556 11:49865558-49865580 CAGAGAGTAAGTGAATGAGGTGG + Intergenic
1083187124 11:61024237-61024259 GAGGGAGAAAGGGAGGGAGGAGG - Intergenic
1083826315 11:65205905-65205927 CAGGTAGTCAGTGAGGGAGCTGG + Intronic
1083828336 11:65215768-65215790 GAGTGAGTGAGTGAGTGAGCAGG + Intergenic
1083828342 11:65215840-65215862 TAGTGAGTGAGTGAGTGAGCCGG + Intergenic
1084181345 11:67448105-67448127 AAAGGAATAAGTGAGGTAGCTGG - Intergenic
1084332517 11:68438311-68438333 TGGGGAGAAAGTGGGGGAGCTGG - Intronic
1084742865 11:71150344-71150366 CAGGGAGGGAGGGAGGGAGAGGG + Intronic
1085039092 11:73316544-73316566 CCTGGAGGAAGTGAGGGAGCAGG + Intronic
1085199516 11:74693282-74693304 CAGGGAATAGGTCGGGGAGCAGG - Intergenic
1085273098 11:75281889-75281911 CAGGGAGAAAGCCAGGGACCTGG + Intronic
1085393175 11:76192971-76192993 AAGTGAGTTAGTGGGGGAGCTGG + Intronic
1085521909 11:77144065-77144087 CAGCTAGTAAGTGATGGTGCTGG + Intronic
1085569421 11:77546396-77546418 CAGCCAGGAAGTGATGGAGCTGG - Intronic
1085767873 11:79299323-79299345 CAGCTAGTAACTGAAGGAGCCGG + Intronic
1086286950 11:85261860-85261882 CAGGGGGAAGGTGAGGGAGAAGG + Intronic
1086320485 11:85641733-85641755 AAGGGAGGGAGTGAGGGAGGGGG + Intergenic
1086487275 11:87320275-87320297 CAGTTAGTAAATGAAGGAGCTGG + Intronic
1086525380 11:87719399-87719421 CAGGGAGGAGGTAAGGGAGGAGG - Intergenic
1087111957 11:94480143-94480165 CAGGCAATAAGTGATAGAGCTGG - Intronic
1087873137 11:103324508-103324530 CAGCAAGGAAGTGAAGGAGCTGG - Intronic
1087939006 11:104071024-104071046 TAGTGAGGCAGTGAGGGAGCAGG - Intronic
1088454765 11:110022089-110022111 CAGTGAGCAAGTGTTGGAGCTGG + Intergenic
1088632050 11:111783127-111783149 CATGGGGTGAGTGAGGGAGTAGG - Intronic
1089242155 11:117091071-117091093 TAGGTAGTTAGTGGGGGAGCTGG - Intronic
1089284064 11:117394484-117394506 CAGGGAGCAGGTGAGGGGCCTGG + Exonic
1089396533 11:118139670-118139692 CAGCTAGTAAGTGATAGAGCTGG - Intronic
1089654526 11:119937079-119937101 CAGCTAGTAAGTGGGAGAGCTGG + Intergenic
1089702988 11:120256701-120256723 CAGGAAGAAGGGGAGGGAGCTGG + Intronic
1090367904 11:126223152-126223174 CAGCGAGTGAGGGAGGGGGCTGG + Intronic
1091143214 11:133253885-133253907 GAGGGAGTGAGGGAGGGAGCAGG - Intronic
1091147039 11:133289016-133289038 CAGGGAGAAACTGAGGGCCCTGG + Intronic
1091506963 12:1081544-1081566 CACAGAGTAAGTGATAGAGCTGG - Intronic
1091778059 12:3197625-3197647 CAGGGAGCCAGTGAGGCTGCAGG + Intronic
1091800159 12:3320043-3320065 CAGGAAGTAAGGGCCGGAGCTGG - Intergenic
1091913563 12:4251129-4251151 CAGCTAGTAAGTGACAGAGCTGG - Intergenic
1092099059 12:5868345-5868367 CAGGGAGTAAGTGGCAGAGCTGG - Intronic
1092233722 12:6792624-6792646 CAGGGTGGATGTGAGGGAGCCGG - Intronic
1092238237 12:6822709-6822731 GAGGGAGGGAGGGAGGGAGCAGG - Intronic
1092247310 12:6871009-6871031 GAGGGAGGAAGAAAGGGAGCCGG - Exonic
1094578611 12:31712042-31712064 GAGGGAGGAAGGGAGGGAGGGGG - Intronic
1095705525 12:45232941-45232963 GAGGAAGAAAGAGAGGGAGCAGG + Intronic
1095752784 12:45729643-45729665 CAGGGAGGGAGGGAGGGAGGGGG - Exonic
1095975589 12:47938954-47938976 CAGGAAGTCAGGGATGGAGCTGG - Intronic
1095989728 12:48026457-48026479 CTGGGAGAAGGTGGGGGAGCAGG - Intergenic
1096458805 12:51810304-51810326 GAGAGAGTGAGTGAGTGAGCAGG - Exonic
1096611287 12:52803741-52803763 GAGGGACAAAGGGAGGGAGCAGG - Intergenic
1096913667 12:55009561-55009583 AAGGGAGTTAGTTAGGGAGAGGG + Intergenic
1097607926 12:61778710-61778732 CAGCTAATAAGTGAGAGAGCCGG - Intronic
1098389666 12:69956220-69956242 CAGGTAGTAAGTGATGGAGCTGG + Intronic
1099039307 12:77631235-77631257 CAGGGAGTAGCTGAGGGACTGGG - Intergenic
1099252705 12:80276530-80276552 TAGGGAGTATGTGAAGGAGCTGG + Intronic
1099370758 12:81826877-81826899 CAGGGAGCAAGGGTGGAAGCAGG - Intergenic
1099385272 12:82006163-82006185 GAGGGAGGGAGGGAGGGAGCAGG + Intergenic
1099980275 12:89592640-89592662 CAGGTAGTAAGTGGCAGAGCTGG - Intronic
1100600350 12:96107446-96107468 CAGGGAGGAAGTGGGGGGCCAGG - Intergenic
1101642172 12:106594885-106594907 AAGGGAGAAAGAGAGGGAGGGGG + Intronic
1101839744 12:108319472-108319494 CAGGTAGTAAGTGACAGAGCTGG - Intronic
1101985202 12:109440698-109440720 CAGGGAGTGAGTGAGGCAAGTGG + Intronic
1102033369 12:109757474-109757496 CAGGGAATAAGTGACAGAGGAGG + Intronic
1102327649 12:112001944-112001966 CAGCTAGTAAGTGTTGGAGCTGG - Intronic
1102881018 12:116485048-116485070 CAGAGAGTAAGGGATGAAGCTGG - Intergenic
1103227597 12:119301592-119301614 CAGCGGGTAAGTGATGAAGCCGG - Intergenic
1103797316 12:123513349-123513371 CAAGGAGTAAATGAGTGAGTGGG - Intronic
1103977152 12:124710555-124710577 CGGGGATTAAGTGAGCTAGCTGG - Intergenic
1104143074 12:126006846-126006868 GAGGGAGCAAGTGTGGGAACTGG + Intergenic
1104191089 12:126482472-126482494 GAGGGAGGAAGTGGGGGAGGAGG - Intergenic
1104263449 12:127206944-127206966 CAGCTAGTAAGTGACAGAGCTGG + Intergenic
1104508262 12:129353087-129353109 CAGGGAGGGAGGGAGGGAGGGGG - Intronic
1105256017 13:18744510-18744532 GATGGAGAAAGTGAGGGAACAGG + Intergenic
1105972934 13:25447502-25447524 CAGGGAGCAGGTGCAGGAGCTGG + Intronic
1106808472 13:33335345-33335367 CAGGGTGTCACAGAGGGAGCTGG - Intronic
1107149067 13:37091101-37091123 CAGGGAGCCAGTGAAGGTGCTGG + Intergenic
1107260553 13:38485458-38485480 CAGAGAGAAAGTGAGAGAGGAGG + Intergenic
1107743392 13:43479122-43479144 CAGTAAGTAAGTGAGGCAGAAGG + Intronic
1108024976 13:46168384-46168406 AATGGAGCAAGTGAGGGAGTGGG + Intronic
1108324955 13:49320963-49320985 CAGGAAGGAAGTGAGGGTGGTGG + Intronic
1108357752 13:49642600-49642622 AAGGGAGGGAGGGAGGGAGCTGG + Intergenic
1108601988 13:52002634-52002656 GAATGAGTAAGTGAGGGAGGAGG - Intronic
1109181572 13:59220059-59220081 AAGGGAGGAAGGGAGGGAGGAGG + Intergenic
1109321546 13:60816580-60816602 AAGGGAGGAAGGGAGGGAGGAGG - Intergenic
1110416925 13:75263100-75263122 CAGCTAGTAAGTGAGGAAGTTGG - Intergenic
1110417372 13:75268050-75268072 CAAGAAGTAAGTGCAGGAGCGGG + Intergenic
1110479047 13:75952664-75952686 CAAGGAATAAGTGACAGAGCAGG - Intergenic
1112184308 13:97113409-97113431 GAGGGAGGAAGGGAGGGAGGTGG - Intergenic
1113340888 13:109424704-109424726 CAGCTAGTAAATGATGGAGCTGG + Intergenic
1113431540 13:110255559-110255581 CAGGCAGGAAGGGAGGGGGCAGG + Intronic
1113431557 13:110255602-110255624 CAGGCAGGAAGGGAGGGGGCAGG + Intronic
1113431574 13:110255645-110255667 CAGGCAGGAAGGGAGGGGGCAGG + Intronic
1113593928 13:111518254-111518276 GAGGGGGAAGGTGAGGGAGCCGG - Intergenic
1113674106 13:112196327-112196349 GAGGGCGTAAGGGAGGGAGGAGG - Intergenic
1114270819 14:21098674-21098696 GAGGGAGGAAGGGAGGGAGCGGG + Intronic
1115505722 14:34092581-34092603 GAGGAAGCAAGTGAGGGGGCAGG + Intronic
1116379881 14:44252533-44252555 CAGGGAGTAAGGGAGAGAGAAGG + Intergenic
1116852588 14:49923552-49923574 AAGGGAGGAAGGGAGGGAGTGGG - Intergenic
1117168136 14:53060411-53060433 CAAGGAGGCAGTGAGAGAGCAGG - Intronic
1117523915 14:56578652-56578674 CAGGAAGTGAGTGAGGAGGCAGG + Intronic
1118280061 14:64420169-64420191 CAGGGAGAAAGTGAGAGGGAGGG + Intronic
1119279664 14:73394678-73394700 TAGGGAGGAAGAGAGGGAACAGG - Intronic
1119494348 14:75065842-75065864 CAACCAGTAAGTGATGGAGCTGG + Intronic
1119566327 14:75632190-75632212 CAGGTATTAAGTGATGGAGCTGG - Intronic
1119666401 14:76488305-76488327 CAGGGAGGAAGAGAGTGATCAGG + Intronic
1119978525 14:79053373-79053395 CAGGTAGGAAGTGACAGAGCTGG + Intronic
1120157691 14:81112145-81112167 CAGTTAGTAAGTGATGGGGCTGG - Intronic
1120452271 14:84683660-84683682 CAGGGAGGGAGGGAGGGAGGGGG - Intergenic
1120677933 14:87443493-87443515 GAGGGAGGAAGGGAGGGAGGGGG + Intergenic
1121468211 14:94129411-94129433 GAGGGAGGAAGGGAGGGAGAGGG + Intronic
1121489827 14:94349830-94349852 AAGGGAGGAAGGGAGGGAGGGGG - Intergenic
1121563491 14:94891964-94891986 CAGAGAGTAAGTGGTGGGGCTGG + Intergenic
1121563588 14:94892633-94892655 CAGGGAGTAAGTGGCAGGGCAGG - Intergenic
1121618534 14:95330504-95330526 CAGGGAGGAAGTGGTGGAGCTGG - Intergenic
1121697951 14:95928302-95928324 CAGGGAGAGAGGGAGGGAGAGGG - Intergenic
1121782363 14:96630078-96630100 GAGGGAGTGGGTCAGGGAGCTGG + Intergenic
1121791853 14:96704786-96704808 CAGGAAGCAGGTGAGGGAGTTGG - Intergenic
1121800147 14:96768490-96768512 GAGGGAGGAAGGGAGGGAGGAGG - Intergenic
1121884953 14:97534543-97534565 CAGGAAGTGAGCTAGGGAGCGGG + Intergenic
1121916724 14:97842348-97842370 GAGGGAGTGAGGGAGGGAGGAGG + Intergenic
1122155108 14:99746191-99746213 CAGGGAGTAACTGAGACAGATGG + Intronic
1122365050 14:101190044-101190066 GAGGGAGGGAGTGAGGGAGAAGG + Intergenic
1122704511 14:103611761-103611783 CAGGGACTGAGTGAGGGGGATGG + Intronic
1202835994 14_GL000009v2_random:77518-77540 GATGGAGGAAGTGAGGGAACAGG - Intergenic
1123568919 15:21581823-21581845 TAGGGAGTGTGTGTGGGAGCTGG + Intergenic
1123605028 15:22017144-22017166 TAGGGAGTGTGTGTGGGAGCTGG + Intergenic
1123827922 15:24101688-24101710 CAGGGAGTGAGGGAGGAAGGTGG + Intergenic
1123842381 15:24261099-24261121 CAGGGAGTGAGGGAGGAAGGTGG + Intergenic
1123857410 15:24427158-24427180 CAGGGAGTGAGGGAGGAAGGTGG + Intergenic
1123862041 15:24477690-24477712 CAGGGAGTGAGGGAGGAAGGTGG + Intergenic
1124361604 15:29040521-29040543 CAGGGATTAAGTCTGGGACCCGG - Intronic
1125602365 15:40922740-40922762 CAGGGAGTCTGCGGGGGAGCAGG + Intergenic
1125769525 15:42155971-42155993 CAGGGAGCAAGCAAGGGAGGGGG - Intronic
1126101623 15:45121414-45121436 CAGGGAGAAAGGGAGGGAAGAGG - Intronic
1126380155 15:48038271-48038293 CAGGTAGTAAGTGGAGGAGGTGG + Intergenic
1126703476 15:51387026-51387048 CAGGGAGTCATTGAGGCACCTGG + Intronic
1127762670 15:62154268-62154290 CAGGTAGTAAGTGAAGGAGCTGG - Intergenic
1127885425 15:63195438-63195460 CAGGCAGCAAGTCAGGGAGGAGG + Intronic
1128096658 15:64961411-64961433 CAGGCAGTAAGGGGTGGAGCTGG - Intergenic
1128264721 15:66255718-66255740 CAGTTAGTAAGTGGTGGAGCAGG - Intergenic
1128329004 15:66743519-66743541 CAGCCAGTTAGTGAAGGAGCTGG + Intronic
1128514627 15:68334632-68334654 CAGACAGCAAGTGAGGGAGGGGG + Intronic
1128716348 15:69911199-69911221 CAGGGAATGAGTGAGTGAGCTGG + Intergenic
1128996687 15:72302258-72302280 CAGGGAGGAATTGAGAGATCTGG + Intronic
1129185485 15:73903524-73903546 CAGGCAGCATGTGAGGGAGTAGG - Intergenic
1129228910 15:74185598-74185620 CAGGGAGAGGGTGAGGGAGCTGG - Intronic
1129993447 15:79984514-79984536 ATGGCAGTAAGTGATGGAGCTGG + Intergenic
1130146496 15:81278261-81278283 CAGGGAGTGACTGAGGGTGCAGG + Intronic
1130255890 15:82325911-82325933 CAGGGAGGAGCAGAGGGAGCTGG + Intergenic
1130517740 15:84639136-84639158 CAGGGGGAAAGGGTGGGAGCAGG - Intergenic
1130748784 15:86686907-86686929 CAGCTAGTAAGTGATGAAGCTGG + Intronic
1130964587 15:88687404-88687426 CAGCTAGTAAGTGATGGAGCTGG - Intergenic
1131056483 15:89378181-89378203 CAGGGAGTGGGTGGAGGAGCTGG + Intergenic
1131355325 15:91740658-91740680 CACCAACTAAGTGAGGGAGCTGG - Intergenic
1131961327 15:97792871-97792893 CAGGAAGTCAGTGATGGAGCGGG - Intergenic
1132027092 15:98412793-98412815 GAGGAAGGAAGGGAGGGAGCGGG + Intergenic
1132035909 15:98484494-98484516 CAGCCAGTAAGTGATGTAGCTGG + Intronic
1132136388 15:99344308-99344330 CAGTTAGTAAGTGAGGAAGCAGG + Intronic
1132250594 15:100332960-100332982 CAGTGAGACAGTGAGGGAGGAGG - Intronic
1202977273 15_KI270727v1_random:308913-308935 TAGGGAGTGTGTGTGGGAGCTGG + Intergenic
1133027391 16:2994771-2994793 CAGGGAGCAGGTGAGGAACCTGG - Intergenic
1133218293 16:4306800-4306822 CGGGGAGAAAGGGTGGGAGCCGG - Intergenic
1133275550 16:4636260-4636282 CAGGGAGGAAGTCAGGGGGGTGG - Intronic
1133567402 16:7008751-7008773 GAGGGAGGAAGGGAGGGAGGAGG - Intronic
1133612481 16:7446655-7446677 CAGGGAGTTACTGAGGCTGCTGG - Intronic
1133731446 16:8581883-8581905 CAGGCAGTCAGGGAAGGAGCAGG - Intronic
1133934943 16:10261297-10261319 CAGCCAGTAAGGGTGGGAGCTGG + Intergenic
1134096786 16:11423763-11423785 CAGGGAGGAACTGAGAGACCAGG + Intronic
1134145286 16:11755831-11755853 CAGGCAGTGAGTGACGGAGCCGG + Intronic
1134178760 16:12030673-12030695 CGGGGAATAAGTGGGGGAGTGGG - Intronic
1134230470 16:12425221-12425243 CAGGGTGAAAGTGAGGGGTCAGG + Intronic
1134304680 16:13021456-13021478 CAGGAAGTGAGTTAGGGAGAGGG + Intronic
1134439108 16:14286939-14286961 CAGGGAGAGAGGGAGGGAGCAGG + Intergenic
1134634467 16:15781706-15781728 CAGAGAGTAAGTGAGGCAGGGGG - Intronic
1134683920 16:16145708-16145730 CAGGGAGAAAGTGGGGTGGCTGG - Intergenic
1135064938 16:19301468-19301490 CAGGTAGGAAGTGATGGAGCTGG - Intronic
1135160405 16:20089987-20090009 CAGGGAGTAAATGATGAGGCAGG - Intergenic
1135305503 16:21364416-21364438 CGGGGAATAAGTGGGGGAGTGGG - Intergenic
1135477004 16:22785684-22785706 CATGGTGAAAGTGAGAGAGCAGG + Intergenic
1135688851 16:24520314-24520336 CATGGAGTACGTGGTGGAGCTGG + Intergenic
1135929502 16:26724705-26724727 CAGGGAGTAACTGAGAGTTCAGG + Intergenic
1135956373 16:26959762-26959784 GAGGGAGGAAGAGAGGGAGAGGG - Intergenic
1136122966 16:28152398-28152420 CAGTTAGTAAGTGGTGGAGCTGG - Intronic
1136252128 16:29012297-29012319 CAGGGAGCAAGTGGGGGAGGTGG - Intergenic
1136460980 16:30409849-30409871 CAGCGGGTAAATGATGGAGCTGG - Intronic
1136553950 16:30997089-30997111 CAGGGAGGTAGTCAGGGATCAGG + Intronic
1136589066 16:31206318-31206340 GAGGGAGCAAGGGAGGGAGAGGG - Intergenic
1137218676 16:46426531-46426553 GAGGGAGAAAGGGAGGGAGGAGG - Intergenic
1137583780 16:49651545-49651567 CACATAGTAAGTGGGGGAGCTGG - Intronic
1137679133 16:50323960-50323982 CAGACAGGAAGTGAGGGGGCGGG - Intronic
1138060991 16:53890016-53890038 CAGCTAATAGGTGAGGGAGCTGG + Intronic
1138143558 16:54588667-54588689 GAGGGAGAAAGTGAGAGAGAGGG - Intergenic
1138391384 16:56672444-56672466 CAGGGATTAAATGAGAGAGTGGG + Intronic
1138491374 16:57378945-57378967 CAGCCAGCAAGTGATGGAGCAGG - Intronic
1139210043 16:65068044-65068066 AAGGGAGGAAGGGAGGGAGGGGG + Intronic
1139272893 16:65700053-65700075 CAGGGAGAACATGAGTGAGCTGG - Intergenic
1139441653 16:66971026-66971048 CAGGGAGGCAGAGAGGCAGCTGG + Intronic
1139489307 16:67278199-67278221 CTGGGAGTTAGGGATGGAGCAGG + Exonic
1140191263 16:72819206-72819228 GAGGGAGGGAGGGAGGGAGCCGG - Intronic
1140203186 16:72911332-72911354 CAGGAAGTAATTGAGGGAAAAGG + Intronic
1140426536 16:74866043-74866065 CAGGGAGGGAGGGAGGGAGGGGG + Intergenic
1140887952 16:79261089-79261111 CCGGGAGCAGGTGAGGAAGCTGG + Intergenic
1140962169 16:79926641-79926663 CAGCTAGTAAGTGACAGAGCTGG + Intergenic
1141635164 16:85310654-85310676 CAGGGAGGGAGGGAGGGAGCAGG + Intergenic
1141732719 16:85833682-85833704 GAGGGAGTCAGTGAGGGAGAGGG + Intergenic
1141753290 16:85974139-85974161 CAGGGAGTAATAGGAGGAGCAGG - Intergenic
1141798567 16:86291580-86291602 CAGGGAGTGCATGAGGAAGCTGG + Intergenic
1141883308 16:86874272-86874294 CAGTGAATGAGTGAGGGAGCTGG - Intergenic
1142173005 16:88632554-88632576 CAGGAAGTAGATGAGGGAGATGG - Intergenic
1142280913 16:89147144-89147166 CACAGAGTGAGTGAGGGAGGAGG + Intronic
1142280934 16:89147223-89147245 CACAGAGTGAGTGAGGGAGGAGG + Intronic
1142280942 16:89147253-89147275 CACAGAGTGAGTGAGGGAGGAGG + Intronic
1142280977 16:89147363-89147385 CACAGAGTGAGTGAGGGAGGAGG + Intronic
1142280985 16:89147393-89147415 CACAGAGTGAGTGAGGGAGGAGG + Intronic
1142280993 16:89147423-89147445 CACAGAGTGAGTGAGGGAGGAGG + Intronic
1142281001 16:89147453-89147475 CACAGAGTGAGTGAGGGAGGAGG + Intronic
1142281009 16:89147483-89147505 CACAGAGTGAGTGAGGGAGGAGG + Intronic
1142425616 16:90000826-90000848 CAGGGAGTAGGAGTGGGAGTGGG + Intergenic
1142643354 17:1297410-1297432 CAGTGAGAAAGTGTGGGACCTGG - Intronic
1142767808 17:2075514-2075536 CAGAGAGGCAGTGAGGAAGCGGG + Intronic
1142769449 17:2086061-2086083 CAGGTGGTAAGTGAGGGCCCAGG + Intronic
1142781097 17:2181904-2181926 AAGGGAGTGAGAGAGGGAGGAGG + Intronic
1142864633 17:2783112-2783134 CAGCTAGTAAGTGATGGAGCCGG + Intronic
1142887291 17:2920635-2920657 CAGGGATTAAAGGAGGAAGCAGG + Intronic
1142967166 17:3588854-3588876 CAGGTAGTATCTGAGGCAGCTGG - Intronic
1143224085 17:5285752-5285774 CAGCTATTAAGTGGGGGAGCAGG + Intronic
1143266732 17:5643535-5643557 CAGGTAGTAAGTGGCAGAGCTGG + Intergenic
1143601716 17:7950959-7950981 CAGGGAGGGAGGGAGGGAGGGGG + Intergenic
1143624944 17:8104296-8104318 CAGGGGGAAAGTGAGGAAGTAGG + Intronic
1143972050 17:10803096-10803118 CAGGGAGGAAGTGAACGAGAGGG + Intergenic
1144461296 17:15460664-15460686 CAGGGGGCAAGTGTGGGAGCAGG - Intronic
1144512994 17:15893506-15893528 CAGGGAGGAAGAAAGGGAGGAGG - Intergenic
1144642531 17:16945454-16945476 CAGGGAATGCGTGAGTGAGCTGG - Intronic
1144871022 17:18371009-18371031 GAGGGAGGGAGGGAGGGAGCCGG + Intergenic
1144993581 17:19250847-19250869 GAGGCAGTAAGTGAGGGGGGAGG - Intronic
1145018982 17:19415571-19415593 CGAGGAGTATGTGAGGCAGCAGG + Exonic
1145890161 17:28408452-28408474 CTTGAAGGAAGTGAGGGAGCCGG - Intergenic
1145950378 17:28812469-28812491 CAGGGTGGAGGTGAGGGGGCGGG - Intronic
1146017714 17:29247135-29247157 CAGGGAGAAGGTATGGGAGCAGG + Intronic
1146297145 17:31659139-31659161 AAGGGAGAAAGAGAGGGAGAGGG + Intergenic
1146442696 17:32910868-32910890 CATGGGGTAGGTGAGGGAGGTGG + Intergenic
1146488408 17:33262319-33262341 GAGGGAGAAAGGGAGGGAGGGGG + Intronic
1146544857 17:33729244-33729266 GAGGGAGCAAGAGAGAGAGCAGG + Intronic
1146693806 17:34893956-34893978 CAGGGAGGAAGTGGTAGAGCTGG - Intergenic
1146826943 17:36031314-36031336 CAGGCAGGATTTGAGGGAGCAGG + Intergenic
1147015762 17:37490098-37490120 CAGGGAGCAGGTGGGGGCGCCGG - Intronic
1147390536 17:40106639-40106661 CAGGGAGAATGTGGGGGAGGTGG + Intergenic
1148608920 17:48950907-48950929 CAAAGAGTAAGGGAGGAAGCAGG - Intergenic
1148901974 17:50885068-50885090 GAGGGAGGATTTGAGGGAGCAGG + Intergenic
1148956221 17:51355776-51355798 CAGGGAGGCAGTATGGGAGCGGG - Intergenic
1149343657 17:55713061-55713083 CAGGTAGTAAGTGATAAAGCTGG + Intergenic
1149372916 17:56013131-56013153 GAGGAAGTAAGAGAGGGAGGTGG + Intergenic
1149563448 17:57625818-57625840 CAGGCAGGAACTGGGGGAGCTGG + Intronic
1150078305 17:62213251-62213273 GAGGGAGGAAGGGAGGAAGCGGG - Intergenic
1150477764 17:65487759-65487781 GAGGGAGAAAGAGAGGGAGAGGG + Intergenic
1150477902 17:65488331-65488353 CAGGGAGAGAGAGAGGGAGAGGG + Intergenic
1150554520 17:66242024-66242046 CAGGGAGCAAGAGAAGGAGCTGG - Intronic
1150973796 17:70060814-70060836 CTGGGAGGAAATAAGGGAGCAGG + Intronic
1151018417 17:70584385-70584407 GAGGGAGCATGTGAGTGAGCTGG + Intergenic
1151123334 17:71817682-71817704 GAGGGAGTAAGAGAGAGAGAGGG - Intergenic
1151345088 17:73496520-73496542 AAGGGAGTTAGTGAGAGAGGAGG + Intronic
1151354580 17:73550827-73550849 CAGGGAGGAAGTGAGGTTGCTGG + Intronic
1151475698 17:74343329-74343351 CACACAGTAAGCGAGGGAGCGGG + Intronic
1151725563 17:75881833-75881855 GAGGGAGTAGCAGAGGGAGCCGG + Intronic
1151784440 17:76268499-76268521 CAGGGAGTAGTGGAGGGAGGAGG + Intronic
1151804967 17:76399562-76399584 CTGGGAGGAAGTGGTGGAGCTGG + Exonic
1151882736 17:76904878-76904900 CAGGGAGGCAGTGAGGGTGGTGG - Intronic
1152353349 17:79795288-79795310 GAGGGAGCGAGAGAGGGAGCGGG - Exonic
1152364293 17:79846114-79846136 CAGGGTCTAAGAGAGGGAGCTGG - Intergenic
1152883584 17:82834564-82834586 CAGGGAGAAATGGATGGAGCTGG + Intronic
1152982452 18:291237-291259 CTGGTGGTAAGTGAGGAAGCTGG + Intergenic
1153344773 18:4013381-4013403 CAGTTAGTAAGTGAAGGAGCTGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153778877 18:8477097-8477119 CAGTGGGTAAGTGTGGGAGAAGG - Intergenic
1153961348 18:10142813-10142835 CATGGGGGAAGGGAGGGAGCAGG - Intergenic
1154435014 18:14336168-14336190 GATGGAGGAAGTGAGGGAACAGG - Intergenic
1154975404 18:21452589-21452611 CAGACAGGAAGTGAAGGAGCAGG - Intronic
1155026196 18:21943061-21943083 CTGCTAGTAAGTGATGGAGCCGG - Intergenic
1155263899 18:24073104-24073126 CAGGGAGCACCTGAGGGAGAAGG - Intronic
1155334249 18:24748734-24748756 GAGGGAGGAAGGGAGGGAGGAGG - Intergenic
1155501685 18:26492691-26492713 CATGGAGTCAGAGTGGGAGCTGG + Intronic
1155986770 18:32238430-32238452 CAGCTAGTAAGTGCTGGAGCTGG + Intronic
1156438052 18:37154883-37154905 CAGGAAGAAAGTGAGGCAACAGG - Intronic
1156597641 18:38565862-38565884 GAGGGAGAAAGAGAGGGAGAGGG - Intergenic
1156987507 18:43365869-43365891 AAGGGAGAGAGTGAGGGAGGAGG + Intergenic
1157114209 18:44847886-44847908 CATGAAGTTAGGGAGGGAGCAGG + Intronic
1157294909 18:46435424-46435446 AAGGGAGGAAGGGAGGGAGGAGG + Intronic
1157748021 18:50153799-50153821 GAGTGAGTGAGTGAGCGAGCGGG + Intronic
1158467806 18:57707004-57707026 CAGGAAGAAAATGAGGAAGCAGG + Intronic
1158493344 18:57930176-57930198 CAGACGGTAAGTGAGGGAGCTGG - Intergenic
1159518810 18:69492909-69492931 CAGGTAGTAAATGACAGAGCTGG - Intronic
1159799015 18:72874000-72874022 CAGGGAGTTAGTGAGCGTGTTGG - Intergenic
1159829321 18:73254748-73254770 GAGGAAGTAAGAGAGGGAGGAGG + Intronic
1160221212 18:76979391-76979413 CTGGGAGGAAGTGAATGAGCCGG + Intronic
1160964237 19:1738938-1738960 CAGAGGGTAAGTGAGGGCTCTGG - Intergenic
1161084695 19:2329302-2329324 CACGGAGTAAAAGATGGAGCGGG - Intronic
1161417555 19:4156149-4156171 AAGGGAGGAAGGGAGGGAGGGGG - Intronic
1162061254 19:8096845-8096867 CTGGGAGGAGGTGAGGGAGCTGG - Intronic
1162585312 19:11554572-11554594 CACGCAGTAAGTGAGAGAGATGG - Intronic
1162751191 19:12830393-12830415 CAGGGAGCGAGAGAGGGAGGAGG - Intronic
1162853784 19:13452498-13452520 CAGCAAGTAAGTGATGGAACTGG - Intronic
1162907105 19:13830629-13830651 CAGGGAGTGGCTGAGAGAGCAGG - Exonic
1163238045 19:16040860-16040882 CAGGGACTGAGGGAGGGAGGAGG + Intergenic
1164522255 19:28988476-28988498 GAGGGAGGAAGGCAGGGAGCGGG + Intergenic
1164582676 19:29444355-29444377 CAGGGAGGGAGGGAGGGAGGGGG - Intergenic
1164624947 19:29721083-29721105 GAGGGACTGAGGGAGGGAGCTGG - Intergenic
1165410388 19:35656915-35656937 CAGCTAGGAAGTGATGGAGCAGG + Intronic
1165707384 19:37986202-37986224 CAAGGTGTAAGTGGGGAAGCCGG - Intronic
1166106215 19:40599385-40599407 CAGGGACTAAGTGGGGAAGGAGG - Intronic
1166148282 19:40851954-40851976 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166152425 19:40883739-40883761 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166171305 19:41029263-41029285 CAGGGAATAAGTGAGGGAGCTGG + Intergenic
1166177756 19:41086906-41086928 CAGGGAGTAAGTGAGGGAGCTGG - Intergenic
1166551043 19:43666485-43666507 CAGGGAGGGAGGGAGGGAGGAGG - Intronic
1166592185 19:44009313-44009335 CAGGGTGGAAGGGAGGGAACAGG - Intronic
1166651939 19:44581427-44581449 CGGGGAGTAAGGGAGGAAGCGGG - Intergenic
1166738563 19:45100555-45100577 CAGTGGGTAAGTGGTGGAGCTGG + Intronic
1166769145 19:45270288-45270310 CAGCGAGTGAGTGGTGGAGCTGG + Intronic
1166908425 19:46132709-46132731 GAGGGAGAAAGGGAGGGAGAGGG + Intergenic
1167093747 19:47362373-47362395 AAAGGAGTAAGTGAGGGTGTTGG + Intronic
1167139644 19:47640839-47640861 CAGCCAGTAAGTGGTGGAGCTGG + Intronic
1167195173 19:48023393-48023415 GAGGGAGGAAGTGAGGGAGGAGG + Intronic
1167604858 19:50476238-50476260 GAGGGAGAAAGCGAGGGGGCGGG + Exonic
1167607324 19:50488446-50488468 CAGGAAGGAAGAGAGGGAGAGGG + Exonic
1167726370 19:51215836-51215858 CAGGGAGGAGGTGAGGGCCCAGG - Intergenic
1168313463 19:55473288-55473310 CAGGGAGTGAAGGAGGGATCTGG - Intergenic
1202636644 1_KI270706v1_random:49844-49866 GATGGAGGAAGTGAGGGAACAGG + Intergenic
925101862 2:1253844-1253866 GAAGGAGGAAGAGAGGGAGCGGG + Intronic
925296978 2:2783749-2783771 CATAGAGTAAGTGAGTGACCAGG + Intergenic
925507701 2:4586767-4586789 GAGGGAGGAAGGGAGGGAGGAGG - Intergenic
925858882 2:8156188-8156210 CAGGAAGTGAGTGATGGAGTTGG - Intergenic
926072529 2:9909838-9909860 GAGCTAGTAAGTGATGGAGCAGG + Intronic
926557231 2:14373279-14373301 CAGGGAGTACTTGAGGGTGGAGG + Intergenic
926695769 2:15769479-15769501 CAGGAAGTAAGTGTTGGAGCTGG + Intergenic
926706653 2:15842341-15842363 GAGGTGGTGAGTGAGGGAGCAGG - Intergenic
926769999 2:16362708-16362730 CAGGTAGTAAGTGATAGAGGAGG + Intergenic
926857062 2:17268470-17268492 CAGGGGGAAAGAGGGGGAGCTGG + Intergenic
927924756 2:27003681-27003703 CATGGGGAAAGTGAGGGATCTGG - Intronic
928074102 2:28247282-28247304 CTGTGAGTTAGTGAGGGAGCAGG - Intronic
928276621 2:29906636-29906658 CAGCCAGTAAGTGAAGGATCTGG - Intronic
928373750 2:30759067-30759089 CAGAGAGGAAGGGAGGGAGGAGG - Intronic
928374884 2:30766057-30766079 CAGGGAGTGGCTGAGGGTGCTGG + Intronic
928654872 2:33440089-33440111 CAGGGAGTTAGTGAGAGGGATGG + Intronic
928675401 2:33646138-33646160 CAGGGGGTGAGGGAGGGAGTGGG + Intergenic
929852096 2:45601490-45601512 CAGATAGTAAGTGATGGAACTGG - Intronic
931417947 2:62099103-62099125 AAGGGAGTAGGGGAGGGAGAAGG + Intronic
931762176 2:65427884-65427906 CTGTGAGTAACTGAAGGAGCTGG - Intronic
932058234 2:68467822-68467844 CTGGGAGTAAGTGTGGGCGGGGG + Exonic
932397243 2:71456415-71456437 CAGGGAGAAGGAGAGCGAGCAGG - Intronic
932596289 2:73095671-73095693 CAGCTAGTAAGTAATGGAGCTGG + Intronic
932709323 2:74050198-74050220 CAGCTAGTAAGTGATGGAGTTGG - Intronic
933109460 2:78379140-78379162 GAGGGAGTGAGGGAGGGAGGGGG + Intergenic
933109499 2:78379229-78379251 GAGGGAGAGAGGGAGGGAGCGGG + Intergenic
933784790 2:85829954-85829976 CAGGAAGTGAGCGAGGGAGAGGG + Intergenic
934682467 2:96294729-96294751 GAGGGAATGAGTGAGGAAGCAGG - Intronic
934922554 2:98357634-98357656 CAAGGAGTCAGTAAGGGGGCTGG + Intronic
935352478 2:102164576-102164598 CAGGCAGTAAGTGATGCAGCTGG + Intronic
935699832 2:105801868-105801890 CTGAGAGAAAGTGATGGAGCTGG + Intronic
935717645 2:105953016-105953038 CAGGGAGGCAGTGTGGGAGTTGG + Intergenic
935966981 2:108488691-108488713 CTGGGAGTAAGAGAGAGAGAGGG + Intronic
936021884 2:109001424-109001446 CAGGCAGTAACTGCAGGAGCTGG + Intergenic
936396582 2:112136561-112136583 CAGAGAGACAGAGAGGGAGCAGG + Intergenic
936456200 2:112676096-112676118 AAGGGAGCAAGAGAGAGAGCAGG - Intergenic
936643715 2:114345337-114345359 GAGGGAGGAAGGGAGGGAGAGGG + Intergenic
936711800 2:115140347-115140369 CAGGCAGCAAGTGAGGCTGCAGG + Intronic
936921003 2:117688037-117688059 CAGAGAGCAAGTGAGGAACCAGG + Intergenic
937074182 2:119089084-119089106 CAAGGAGTAAGGAAGGCAGCAGG + Intergenic
937250535 2:120521100-120521122 CAGGTAGTAAGTGGTGGAGCCGG + Intergenic
937899754 2:127010908-127010930 CAGTGGGCAAGTGAGGGAGTTGG + Intergenic
938136907 2:128766295-128766317 CTGGGAGGCAGTGAGTGAGCGGG - Intergenic
938160232 2:128979105-128979127 CAGAGAGTGAGTCTGGGAGCTGG - Intergenic
938436428 2:131286058-131286080 GATGGAGGAAGTGAGGGAACAGG - Intronic
938714587 2:134008006-134008028 CAGGGAGGGAGGGAGGGAGAAGG + Intergenic
938803513 2:134785324-134785346 CAGCGAGTAAGTGGGCAAGCTGG + Intergenic
939884286 2:147664439-147664461 AAGGGAGAAAGTGAGGAGGCTGG - Intergenic
939933943 2:148265879-148265901 TAGGGAGTATGTGAGGTGGCAGG + Intronic
940349461 2:152665607-152665629 CAGGGAGCAAGTGAGGAAGCTGG - Intronic
940533996 2:154915088-154915110 CAGAGAGCAAGTGAAGGATCAGG - Intergenic
940976226 2:159948125-159948147 CAGCTAGTAAGTGGTGGAGCCGG - Intronic
942469635 2:176246279-176246301 CAGCTAGTAAGTGATGGAGCTGG + Intergenic
942633910 2:177981057-177981079 CAGCTATTAAGTGAAGGAGCTGG - Intronic
942820328 2:180106222-180106244 CGTGGAGGAAGGGAGGGAGCTGG - Intergenic
942925243 2:181424828-181424850 CACTGAGTAAGTGAGTGAGTGGG + Intergenic
943092661 2:183392936-183392958 CAGAGAGAAAGAGAGGGAGATGG + Intergenic
943112582 2:183624215-183624237 AAATGAGTAAGTGAGGGAGAAGG + Intergenic
944635651 2:201673896-201673918 AAGGGGGTAAGGGAGGGAACTGG - Intronic
944865176 2:203852843-203852865 GAGGGAGGAAGGGAGGGAGGGGG - Intergenic
945192037 2:207198605-207198627 GAGGGAGTTTGTGAGGGACCTGG + Intergenic
945221473 2:207488657-207488679 CAGAGTGTAAGGGAGTGAGCAGG + Intergenic
945581333 2:211598936-211598958 CAGCAAGTAAATGATGGAGCAGG - Intronic
945585812 2:211661051-211661073 CGGGGAGGGACTGAGGGAGCAGG + Intronic
945724049 2:213453319-213453341 GTGGTAGTAAGTGAGAGAGCTGG + Intronic
946249574 2:218404415-218404437 CAGGGAGCTAGTGAGGGTGATGG + Exonic
946407957 2:219502125-219502147 CCGGGAGTTGGTGTGGGAGCTGG + Intronic
946831930 2:223736311-223736333 CAGAGAGTAAGTGCCTGAGCTGG + Intergenic
947077739 2:226363973-226363995 GAGGGAGGAAGGGAGGGAGGAGG + Intergenic
947077786 2:226364092-226364114 GAGGGAGGAAGGGAGGGAGGAGG + Intergenic
947077834 2:226364200-226364222 GAGGGAGGAAGGGAGGGAGGAGG + Intergenic
947246932 2:228058950-228058972 CTGGGGTTAAGTGAGGGAGAGGG - Intronic
947356420 2:229300607-229300629 CAGGGAGTATCTGAGGGACAAGG - Intergenic
947750630 2:232530206-232530228 CCAGGAGGAAGTGAGGGGGCAGG - Intronic
947765784 2:232636295-232636317 CAGGGAGCAAGTGGTGGGGCTGG - Intronic
947963938 2:234263011-234263033 CACATAGTAAGAGAGGGAGCAGG - Intergenic
947998718 2:234549698-234549720 GAGGGAGAAAGGGAGGGAGTGGG - Intergenic
948082578 2:235218871-235218893 GAGACTGTAAGTGAGGGAGCTGG - Intergenic
948282107 2:236754729-236754751 CAGGTAGTAAGTGGAGGAGCTGG - Intergenic
948866446 2:240777475-240777497 CAGGGAGGCGGTGAGGGAGCAGG - Intronic
1168744055 20:221292-221314 GAGGGAGGGAGGGAGGGAGCAGG + Intergenic
1168751349 20:284103-284125 CAGGGAGAGAGTGAGGGTCCCGG + Intronic
1169032000 20:2416820-2416842 TATGTGGTAAGTGAGGGAGCTGG - Intronic
1169568989 20:6886477-6886499 CAGGGAGTTAGTCAGGGTACTGG - Intergenic
1169747822 20:8961262-8961284 GAGGGAGCAAGAGAGGGAGAAGG + Intronic
1170411886 20:16101253-16101275 GAGGGAGAAAGAGAGGGAGAGGG - Intergenic
1171096361 20:22336018-22336040 CAGGGAGGGAGGGAGGAAGCTGG - Intergenic
1171178988 20:23077596-23077618 GAGGGAGGAAGGGAGGGAGAGGG - Intergenic
1171178995 20:23077614-23077636 AAGGGAGGAAGGGAGGGAGAGGG - Intergenic
1171415790 20:24979642-24979664 CAGGGGTCAAGGGAGGGAGCAGG - Intronic
1171959954 20:31486079-31486101 CAGGGAGACAGTGCAGGAGCTGG + Intergenic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1172617447 20:36298567-36298589 AAGGGAGTAAGTGGTGGAGCCGG - Intergenic
1172644025 20:36458816-36458838 CAGGGTGGCAGTGAGGGAGGTGG + Intronic
1172700141 20:36848252-36848274 CAGGGAGTGGGTGGGTGAGCAGG - Intronic
1172750172 20:37245305-37245327 TGGGGAGGAAATGAGGGAGCTGG - Intergenic
1172765648 20:37349342-37349364 CTGGGAGTGAGGTAGGGAGCAGG + Intronic
1172853792 20:37985485-37985507 CAGGGAGGCAGTGGGGGAGTGGG + Intronic
1172884861 20:38224051-38224073 CAGCTTGTAAGTGATGGAGCTGG - Intronic
1172904094 20:38356024-38356046 AAGGGAGAAAGTGATGGAGGAGG + Intronic
1173072747 20:39785319-39785341 CAGCTAGCAAATGAGGGAGCTGG + Intergenic
1173362361 20:42356094-42356116 CACGAAGTTAGTGAGGGATCGGG + Intronic
1173427493 20:42955817-42955839 GAGGGAGGGAGTGAGGGAGAAGG + Intronic
1173452914 20:43181008-43181030 GAGTGAGCAAGTGAGAGAGCCGG - Intronic
1173579426 20:44136721-44136743 CAAGTTGGAAGTGAGGGAGCTGG - Intronic
1173741276 20:45404236-45404258 CAGCTAGTAAGTGATGGACCTGG - Intronic
1173856842 20:46255705-46255727 AAGGGAGGAAGGGAGGGAGGAGG - Intronic
1173865177 20:46308455-46308477 GAGGGAGTGAGCGAGCGAGCGGG + Exonic
1173881578 20:46417076-46417098 CAGGGTGGATGGGAGGGAGCTGG - Intronic
1174105768 20:48161275-48161297 TTGGGAGTGAGTGAGGGGGCAGG - Intergenic
1174174974 20:48638861-48638883 CAGCCAGTAAGTGGGTGAGCTGG + Intronic
1174220370 20:48949563-48949585 GATGGAGTAACTGAAGGAGCAGG - Intronic
1174408314 20:50317417-50317439 CAGGGAGGACGAAAGGGAGCTGG - Intergenic
1174408686 20:50320043-50320065 CAGGGAGGACGAAAGGGAGCTGG - Intergenic
1175150871 20:56932924-56932946 CAGCTAGGAAGTGATGGAGCTGG + Intergenic
1175239778 20:57538546-57538568 CCAGAAGGAAGTGAGGGAGCAGG + Intergenic
1175417186 20:58809508-58809530 CAGCTAGTTAGTGAGGGGGCTGG + Intergenic
1175491755 20:59384609-59384631 CAGGGAGGAAGTGGGGGGGAAGG + Intergenic
1175491773 20:59384668-59384690 CAGGGAGGAAGTGGGGGGGAAGG + Intergenic
1175491791 20:59384727-59384749 CAGGGAGGAAGTGGGGGGGAAGG + Intergenic
1175491809 20:59384786-59384808 CAGGGAGGAAGTGGGGGGGAAGG + Intergenic
1175491826 20:59384845-59384867 CAGGGAGGAAGTGGGGGGGAAGG + Intergenic
1175491844 20:59384904-59384926 CAGGGAGGAAGTGGGGGGGAAGG + Intergenic
1175491862 20:59384963-59384985 CAGGGAGGAAGTGGGGGGGAAGG + Intergenic
1175491880 20:59385022-59385044 CAGGGAGGAAGTGGGGGGGAAGG + Intergenic
1175491898 20:59385081-59385103 CAGGGAGGAAGTGGGGGGGAAGG + Intergenic
1175761262 20:61563414-61563436 CCTGGAGCAAGTGAGGGAGAAGG - Intronic
1175918660 20:62439664-62439686 CAGGGAGGGAGAGAGAGAGCAGG - Intergenic
1175951807 20:62587658-62587680 CAGAGAGCAAGTTAGGGAGCCGG + Intergenic
1176130265 20:63493817-63493839 CAGGGAGCAGGGGAGGGGGCCGG + Intronic
1176358878 21:5975937-5975959 CAGGGAGCAAGTGGCAGAGCAGG + Intergenic
1176842023 21:13849534-13849556 GATGGAGGAAGTGAGGGAACAGG + Intergenic
1176908795 21:14537280-14537302 CTGGAAGAAAGTGAAGGAGCTGG - Intronic
1178057089 21:28811445-28811467 CAGGGAGGGAGGGAGGGAGAGGG + Intergenic
1178413878 21:32388171-32388193 CAGCTAGTAAGTGACTGAGCGGG - Intronic
1178512358 21:33216151-33216173 CAGAGACTCAGTGAGGGAACCGG + Intergenic
1178666034 21:34547330-34547352 CAGTGAGCAGGTGAGGGAGGGGG - Intronic
1178793492 21:35722089-35722111 CAGGGAGTCAGGGAGGATGCTGG - Intronic
1178912353 21:36685589-36685611 CAGATGGTAAGGGAGGGAGCTGG - Intergenic
1178998299 21:37428102-37428124 CAGCTAGTAAGGGATGGAGCTGG + Intronic
1179101556 21:38359272-38359294 CATGGAGGAAATGAGGAAGCAGG + Intergenic
1179171916 21:38979813-38979835 CACGCAGTCAGTGAGTGAGCAGG + Intergenic
1179289807 21:40008525-40008547 TGGGGAGTCAGGGAGGGAGCTGG + Intergenic
1179452127 21:41474373-41474395 GAGGGAGTGAGTGAGGGGGTGGG + Intronic
1179452155 21:41474453-41474475 GAGGGAGTGAGTGAGGGGGTGGG + Intronic
1179452262 21:41474766-41474788 GAGGGAGTGAGTGAGGGGGTGGG + Intronic
1179452325 21:41474936-41474958 GAGGGAGTGAGTGAGGGGGTGGG + Intronic
1179764640 21:43562613-43562635 CAGGGAGCAAGTGGCAGAGCAGG - Intronic
1179893440 21:44349324-44349346 CAGGGAGGAAATGAGGGTGGCGG + Intergenic
1180364226 22:11924469-11924491 GATGGAGGAAGTGAGGGAACAGG - Intergenic
1180813899 22:18777970-18777992 CAGCGAGTAGATGAAGGAGCTGG + Intergenic
1181200084 22:21212305-21212327 CAGTGAGTAGATGAAGGAGCTGG + Intronic
1181675771 22:24450704-24450726 CAGGGAGAGAGAGAGGGAGAGGG + Intergenic
1181687266 22:24538022-24538044 TAGAGAATAAGTGAGGGACCAGG + Intergenic
1181701651 22:24624654-24624676 CAGCGAGTAGATGAAGGAGCTGG - Intronic
1181998570 22:26902570-26902592 AAGGAAGGAAGGGAGGGAGCAGG - Intergenic
1182043810 22:27259022-27259044 CAGGGATGGAGTGAGGGACCTGG + Intergenic
1182066982 22:27437942-27437964 CTGGGAGTAAGTGCCGGGGCTGG + Intergenic
1182739222 22:32554835-32554857 CAGCGAATAAGTGATGGAGTTGG - Intronic
1182913091 22:34004037-34004059 CAGGGAGGCAGTGAGGGTCCTGG + Intergenic
1182936146 22:34223552-34223574 CAAGGAGCAAGTGAGGGAGGTGG + Intergenic
1183090529 22:35519079-35519101 CAGAGAATGAGAGAGGGAGCAGG - Intergenic
1183257580 22:36772296-36772318 CAGCTAGAAAGTGATGGAGCTGG - Intronic
1183316153 22:37137861-37137883 CCTGGAGGCAGTGAGGGAGCGGG - Intronic
1183972033 22:41484833-41484855 TAGGTAGTAAGTGACAGAGCTGG + Intronic
1184116453 22:42425544-42425566 CAGGGAGGGAAGGAGGGAGCTGG - Intronic
1184476604 22:44725383-44725405 CAGGCAGACAGTGGGGGAGCCGG - Intronic
1184804533 22:46784922-46784944 CAGCTAGTAAGTGTTGGAGCTGG + Intronic
1185274074 22:49942902-49942924 GAGGGAGTGAGGGAGGGAGGGGG + Intergenic
1185281916 22:49975892-49975914 CAGGGAGATAGGGAGGGAGGTGG + Intergenic
1203226752 22_KI270731v1_random:82619-82641 CAGCGAGTAGATGAAGGAGCTGG - Intergenic
1203263998 22_KI270734v1_random:3657-3679 CAGCGAGTAGATGAAGGAGCTGG + Intergenic
949483006 3:4511709-4511731 CAGTGAGTAAGTGGCAGAGCTGG + Intronic
949498280 3:4654267-4654289 CAGGGAGTAAGTATGTGAGGTGG + Intronic
949572581 3:5307942-5307964 CAGGAATTAAGTGGAGGAGCTGG + Intergenic
949585559 3:5433450-5433472 CAGTGAGTAAGTGTTGAAGCTGG + Intergenic
949714872 3:6918475-6918497 CAACTAGTAAGTGATGGAGCTGG - Intronic
949820394 3:8109858-8109880 CAGCCAGTAAGTGACAGAGCTGG - Intergenic
949838170 3:8291735-8291757 AGGGGAGTGAGTGAGGGAGATGG + Intergenic
949838188 3:8291813-8291835 AGGGGAGTGAGTGAGGGAGATGG + Intergenic
949861030 3:8504925-8504947 CAGCTAGTAAGTGGGGGAGCTGG - Intronic
950121592 3:10485520-10485542 CAGGGAGAAGCGGAGGGAGCGGG - Intronic
950127990 3:10522352-10522374 CAGCTAGTAAGTGGAGGAGCTGG + Intronic
950364393 3:12472776-12472798 CAGGTAGTAAGTGACCAAGCTGG + Intergenic
950471784 3:13190877-13190899 CAGGGATTTAGTGAGGCAGAGGG - Intergenic
950552449 3:13675004-13675026 CAAGGAGTGAGGGAGGAAGCAGG + Intergenic
950789836 3:15462988-15463010 CTGGGTGGAAGAGAGGGAGCTGG + Intronic
950887577 3:16374813-16374835 CAGGAAATAAGTCAGCGAGCAGG + Intronic
950939201 3:16876428-16876450 CTTGGAGGAAGTGATGGAGCTGG - Intronic
951840534 3:27029058-27029080 CAGCTAGTAAGTGACAGAGCTGG - Intergenic
952090901 3:29884475-29884497 GAGGGAGGGAGGGAGGGAGCGGG - Intronic
952230531 3:31424916-31424938 GAGGGAGGAAGGGAGGGAGGAGG + Intergenic
952702633 3:36342526-36342548 CAGGGGGAAGGTGAGGGAGAAGG + Intergenic
953898323 3:46822085-46822107 AAGAGAGAAAGTGAGTGAGCGGG + Intergenic
953963018 3:47281642-47281664 GAGGGAGAAAGGGAGGGGGCCGG - Intronic
954384721 3:50238025-50238047 CAGGGAGGAAGAGAAGGGGCGGG + Intronic
954436511 3:50499086-50499108 CAGGGAGTGAGGGAGGGAGGTGG + Intronic
954690992 3:52395479-52395501 CAGGGAGGAAGGGAGTGGGCTGG + Intronic
954697866 3:52437035-52437057 CAGGGAGGAAGTGTGGGGCCAGG + Intronic
954706149 3:52481642-52481664 CAGTGAGTGAGTGAGTGGGCAGG + Intronic
955025946 3:55167479-55167501 CACCAAGTAAGTGAGAGAGCTGG - Intergenic
955113250 3:55971174-55971196 GAGGGAATAAATGAGGGAGAGGG + Intronic
955377313 3:58408842-58408864 CCTGGAGTAAATGAAGGAGCAGG - Intronic
955597099 3:60603084-60603106 AAGGTAGTAAGAGAGGTAGCTGG + Intronic
955664798 3:61338725-61338747 CAGGGAGCAAGAGAGAGAGGAGG - Intergenic
956025175 3:64975734-64975756 CAGTAAGTAAGTGACAGAGCGGG - Intergenic
956258382 3:67309281-67309303 CAGTGAGTGAGGGAGGGCGCAGG - Intergenic
956468538 3:69542205-69542227 CAGGGAGGAGGTGGCGGAGCAGG - Intronic
957511043 3:81187552-81187574 GAGGGAGCAAGAGAGGGAGGAGG - Intergenic
957800588 3:85074712-85074734 CAGACATTTAGTGAGGGAGCTGG - Intronic
958814985 3:98904608-98904630 CAGGGAAAAAGAGAGGGAGGTGG + Intergenic
958986992 3:100792331-100792353 GAGGAAGTTAGAGAGGGAGCAGG + Intronic
959761589 3:109972226-109972248 CAGGTAGTTAGTAATGGAGCTGG + Intergenic
960094722 3:113678031-113678053 GAGGGAGGAAGGGAGGGAGAAGG - Intronic
960459652 3:117917856-117917878 AAGTGAGGAAGTGAGGGAGCAGG - Intergenic
960533127 3:118787696-118787718 CAGTTAGTAAGTGAGAGAGATGG - Intergenic
961868482 3:129971750-129971772 AAGGGAGGAAGGGAGGGAGGAGG + Intergenic
962340092 3:134575274-134575296 AAGGGAGGAAGGGAGGGAGGGGG - Intergenic
962350469 3:134652102-134652124 CAGCCAGGAAGTGATGGAGCTGG - Intronic
962847585 3:139285627-139285649 CAACGGGTAAGTGAGGAAGCTGG - Intronic
963018376 3:140847789-140847811 CAATGAGTAGGTGAGGGAGGCGG + Intergenic
963086015 3:141437338-141437360 CAGAGAGTAAGGGAGGCAGAAGG - Intronic
963112915 3:141701539-141701561 CAGAGAGGAAGCAAGGGAGCTGG + Intergenic
963673812 3:148283561-148283583 CAGGGAGGGAGGGAGGGAGGGGG - Intergenic
964420322 3:156495620-156495642 CAGCTAGTAAGTGATGGAGCTGG - Intronic
964914190 3:161819236-161819258 CAGGTAGTAAGTCAGGGTTCAGG + Intergenic
965069422 3:163899230-163899252 TATGGAGAAAGTGAGGCAGCTGG + Intergenic
965191509 3:165535985-165536007 CAGCTAGTAAGTGACAGAGCTGG - Intergenic
965309053 3:167105835-167105857 CAGCTACTAAGTGAGGGATCTGG + Intergenic
965359630 3:167722604-167722626 CAGGGGCTAAGAGAGTGAGCTGG + Intronic
965942456 3:174201302-174201324 GAGGGAGGAAGGGAGGGAGGCGG + Intronic
965991087 3:174818836-174818858 CAGGGGGAAAGGGAGGGAGTGGG + Intronic
966012527 3:175098458-175098480 GAGGGAGAAAGTGATGGGGCTGG + Intronic
966239989 3:177745230-177745252 CTGGGAGTCCGGGAGGGAGCCGG - Intergenic
966412735 3:179659682-179659704 CAGAGAGTAAGTAGGAGAGCTGG + Intronic
967120340 3:186377268-186377290 CAGTGACTAAGTGGTGGAGCTGG + Intergenic
967186350 3:186948026-186948048 CAGAGAGTGAGGGAGGGAGGAGG + Intronic
967473496 3:189889728-189889750 AAGGGAGTAAGTGAAGGCGAGGG - Intronic
967745723 3:193052739-193052761 CAGGGAGTCCATGAGTGAGCCGG - Intergenic
968135006 3:196214889-196214911 CAGGGTGTCAGTGAGGGAAGGGG - Intronic
968757648 4:2425325-2425347 CAGGGAGAGAGTCAGGGGGCAGG + Intronic
968758213 4:2427665-2427687 CAGGTAGTGAGAGCGGGAGCTGG - Intronic
969126168 4:4949833-4949855 CAGTCAGTAAGGGATGGAGCTGG - Intergenic
969158601 4:5235332-5235354 CAGCCAGTAAATGATGGAGCTGG - Intronic
969571876 4:8013868-8013890 CACGGAGGAAGTGAGTGAGATGG + Intronic
970352402 4:15216041-15216063 CCAGGAGCAAGAGAGGGAGCAGG - Intergenic
971039578 4:22736662-22736684 CAGATAGTAAGTGATGTAGCTGG - Intergenic
971186460 4:24382438-24382460 CAGGAAGTAAGGGAGGGAGGAGG + Intergenic
972185569 4:36523865-36523887 GAGGGAGGAAGGGAGGGAGGAGG - Intergenic
972567635 4:40283686-40283708 AAGGGAGTGAGCGGGGGAGCAGG - Intergenic
972812122 4:42601576-42601598 AAGAGAGTATGTGAGGTAGCCGG + Intronic
973076891 4:45940361-45940383 CAGGAAGGAAGGGAGGGAGGAGG + Intergenic
973366457 4:49213214-49213236 GATGGAGGAAGTGAGGGAACAGG + Intergenic
973394155 4:49579220-49579242 GATGGAGGAAGTGAGGGAACAGG - Intergenic
973603337 4:52562866-52562888 CAAGGAGTAATTGATGGAGTAGG - Intergenic
973765402 4:54157247-54157269 GAGGGAGGGAGGGAGGGAGCCGG + Intronic
974882524 4:67777293-67777315 CAGTTAGTAAGTGACAGAGCTGG + Intergenic
974897829 4:67960415-67960437 AAGCTAGTAAGTGAAGGAGCTGG - Intronic
975222530 4:71829716-71829738 AAGGGAGTCATTGAGGGAGTGGG + Intergenic
975540962 4:75511990-75512012 CTTGGAGTAAGTTAGGGAGGAGG - Intronic
975842081 4:78485730-78485752 CAGAGAGAAAGTGATGAAGCTGG + Intronic
976050414 4:81005518-81005540 CAGAGAGTAAGAGAGGAAGAAGG + Intergenic
976281889 4:83334381-83334403 CTGAGAGTAAGGGAGGGAGAGGG + Intronic
976321855 4:83725473-83725495 AAGGGAGGAAGGGAGGGAGGGGG - Intergenic
976933849 4:90603781-90603803 CAGGGAGTAACTGTAGGAGAAGG + Intronic
976945862 4:90767042-90767064 CAGGGTGTATGTGAGATAGCTGG - Intronic
977468411 4:97411299-97411321 CAGGGAGTAAGTTAAGCATCTGG - Intronic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978768118 4:112425451-112425473 CAGAGAGTAAGTAGGGGAACTGG + Intronic
978784215 4:112591591-112591613 CATGGAGTGAGTGAGTGAGGGGG - Intronic
978887906 4:113787461-113787483 CAGGTAGTATGTGATGGAGCTGG - Intergenic
979407238 4:120328199-120328221 CAGGGATAAAGTGAGGGGGAAGG + Intergenic
979994324 4:127412167-127412189 GAGGGAGGAAGGGAGGGAGAGGG + Intergenic
980169687 4:129274164-129274186 CAGTTAGTAAGTGACAGAGCTGG - Intergenic
980780940 4:137491210-137491232 CAGATAATAAGTGAAGGAGCTGG + Intergenic
982019312 4:151187956-151187978 CAGGGAGTCTGGGAGGGAGAGGG - Intronic
982127075 4:152193382-152193404 CTGGGAGTAATAGAGGGAGGTGG + Intergenic
982353971 4:154446611-154446633 CAGAGAGTAAGGGATTGAGCTGG + Intronic
982739515 4:159043113-159043135 TAGGGAGTTAGTGAGGGAGAAGG - Intergenic
983415545 4:167448472-167448494 CATGGAATAAGAGAGGGAGCTGG - Intergenic
984490681 4:180431061-180431083 CAGGGAGTAAGGGCGGCACCTGG - Intergenic
984744454 4:183200786-183200808 CAGGGAGAGAGAGAGTGAGCAGG + Intronic
984768750 4:183419656-183419678 GAGGGAGGAAGTGAAGGAGGAGG - Intergenic
985120589 4:186637103-186637125 CAGGGAGAGAGTCAGGGGGCCGG + Intronic
985166097 4:187095727-187095749 CAGGGAGAAGGTGAGGCTGCAGG + Intergenic
985309075 4:188577568-188577590 CAGGGAGCAAGAGAGGGGGGAGG + Intergenic
985386998 4:189458552-189458574 CACTCAGTAAGTGAAGGAGCTGG - Intergenic
985704152 5:1390996-1391018 CAGGGAGTGCCTGAGGGAGCAGG - Intergenic
986186776 5:5449651-5449673 CAGGGAGTGGGAGAAGGAGCAGG + Intronic
986293054 5:6415823-6415845 CAAGGAGCAGGTGAGGGTGCAGG - Intergenic
986593403 5:9394613-9394635 CTGGGAGGAGGTGGGGGAGCAGG + Intronic
987144429 5:14978569-14978591 GAGGGAGCAAGAGAGAGAGCGGG + Intergenic
987691966 5:21278858-21278880 CAGGGAGTAATTCAGGAAACTGG + Intergenic
987749894 5:22026178-22026200 CAGGCACTTAGTGAGGGAACAGG + Intronic
988463599 5:31465760-31465782 GAGGGAGGAAGAGAGGGAGGAGG - Intronic
989197111 5:38726375-38726397 CAGGGCATGAGTGAAGGAGCAGG - Intergenic
989784046 5:45305696-45305718 AAGGGAGGAAGGGAGGGAGCAGG + Intronic
990048611 5:51466976-51466998 AAGGGAGGGAGGGAGGGAGCGGG - Intergenic
990832607 5:59976454-59976476 GAGGGAATAAGAGAGGGGGCAGG - Intronic
990931659 5:61098266-61098288 CAGACAGTAAGTGATGAAGCTGG + Intronic
990950141 5:61290527-61290549 CAGGGAGAAAGGGTGGGAGGGGG - Intergenic
991748420 5:69771236-69771258 CAGGGAGTAATTCAGGAAACTGG - Intergenic
991800000 5:70351081-70351103 CAGGGAGTAATTCAGGAAACTGG - Intergenic
991828600 5:70658958-70658980 CAGGGAGTAATTCAGGAAACTGG + Intergenic
991892355 5:71350512-71350534 CAGGGAGTAATTCAGGAAACTGG - Intergenic
991937474 5:71816318-71816340 CATGGAGCAAGTGAGGGCACTGG - Intergenic
992026242 5:72672190-72672212 AAGGGAGCAACTGAAGGAGCAGG + Intergenic
992075999 5:73193182-73193204 CAGGTAGTAAGTAATAGAGCTGG + Intergenic
992747635 5:79835179-79835201 CAGGGGGTCAGTGAGAGGGCAGG + Intergenic
992895334 5:81240337-81240359 CAGGGAGGATCTGAGGCAGCTGG + Intronic
994167819 5:96626295-96626317 TCGGGAGTAAGAGAGGCAGCAGG - Intronic
994254398 5:97576252-97576274 GAGGGAGGAAGGGAGGGAGAGGG - Intergenic
994600371 5:101894789-101894811 CAGGGAGAAAGGGAGGGACATGG + Intergenic
994670030 5:102754114-102754136 CTGGGAGAAAGAGAGGGGGCTGG + Intronic
995501751 5:112814629-112814651 CAGGTAGGAAATGAGGGAGAGGG - Intronic
995625247 5:114069234-114069256 TAAGGAGTAAGTAAGTGAGCTGG - Intergenic
996570439 5:124928037-124928059 AAGGGAGAAAGGGAGGAAGCAGG + Intergenic
997733642 5:136198001-136198023 CAGGTAGCAAGGCAGGGAGCAGG + Intergenic
997860156 5:137408816-137408838 CAGCTAGTAAGTGGTGGAGCTGG - Intronic
998267148 5:140674666-140674688 CAGGGAAGAGGTGAGGGAGGTGG - Exonic
999375411 5:151083164-151083186 CAGGTAGTAAGTGGCTGAGCAGG - Intronic
999692102 5:154157265-154157287 CAGGAAGCAGCTGAGGGAGCGGG + Intronic
1000026158 5:157360981-157361003 CAGGTAGTAAGTAGGGCAGCTGG - Intronic
1000342890 5:160291093-160291115 AAGAAAGTAAGTGAGGGAGTTGG + Intronic
1001319353 5:170667652-170667674 CAGCAGGTAAGTGATGGAGCTGG - Intronic
1001322283 5:170692550-170692572 CAGGGAGTAAGTGCATGAACTGG - Intronic
1001753412 5:174148297-174148319 CAGGGAGTTACCGAGGGAGATGG - Intronic
1001840389 5:174871295-174871317 GAGTGAGTAAGTGAGTGAGTGGG - Intergenic
1001955120 5:175843663-175843685 CAAAGGGTGAGTGAGGGAGCAGG + Intronic
1002355861 5:178627948-178627970 AAGGGCGTAAGTGAGGGAAAGGG + Intronic
1002521766 5:179796316-179796338 CCGGGAGGAAGTGGGCGAGCAGG - Exonic
1002934983 6:1663751-1663773 CATGAAGGAAATGAGGGAGCAGG - Intronic
1003016096 6:2468570-2468592 GAGGGAGTGAGAGAGGGAGAGGG + Intergenic
1003046793 6:2740604-2740626 CAGGGAATAGGTGTGGGGGCTGG - Intronic
1003311857 6:4975638-4975660 CAGGGAGGAAGGGTGGGAGGGGG - Intergenic
1003961155 6:11210725-11210747 AAGGGAGGAAGGGAGGGAGAGGG + Intronic
1003967409 6:11266245-11266267 CCTGGAGTAAGTGAGGGGGGAGG - Intronic
1004016957 6:11740679-11740701 CAGGAAGTTAGTGAGGAAGGAGG - Intronic
1004416364 6:15428020-15428042 GAGGGAGGCAGTGAGGGAACAGG - Intronic
1004591796 6:17059310-17059332 CCGGGAGTAAGCGTGGGAGGTGG - Intergenic
1005002967 6:21261229-21261251 CAGCTAGTAAGTGACAGAGCTGG + Intergenic
1006213157 6:32414520-32414542 AAGGGAGGAAGGGAGGGAGGGGG + Intergenic
1006296550 6:33172490-33172512 CAGAGGGGAAGTGGGGGAGCTGG - Intronic
1006899678 6:37491889-37491911 CAGGCATTAAGTCCGGGAGCTGG + Intronic
1007012993 6:38435618-38435640 GAGGGAGGAAGGGAGGGAGGGGG - Intronic
1007125520 6:39422760-39422782 AAGGGAGTAAGTGAGGAGGGAGG - Intronic
1007660331 6:43480921-43480943 CAGCTAGTAAGTGACAGAGCTGG + Intronic
1007694023 6:43720187-43720209 CAGGCAGCAAGAGTGGGAGCTGG + Intergenic
1007752850 6:44080811-44080833 CAGGGCAGAAGTGAGGGGGCAGG + Intergenic
1007783053 6:44265101-44265123 CAGGGTGTAGGTGAGCGAGGAGG + Exonic
1008058928 6:46976290-46976312 CAGTTAGTAAGTGATGAAGCTGG + Intergenic
1008120854 6:47615527-47615549 GAGGGAGTAAGAGAGAGAGTGGG + Intronic
1008667188 6:53727761-53727783 CAGGGAGGTAGAGAGAGAGCTGG + Intergenic
1008717351 6:54305284-54305306 CTGGGAGTAGGGGAGGGAGAAGG + Intergenic
1009452012 6:63812319-63812341 CTTGAAGGAAGTGAGGGAGCAGG - Intronic
1010585186 6:77650393-77650415 CGTGGGGGAAGTGAGGGAGCAGG - Intergenic
1011371217 6:86638732-86638754 CAGGGAGCAAGAGAGAGAGCAGG - Intergenic
1011484543 6:87828540-87828562 CAGGCAGTTAGTGAGGAAACAGG - Intergenic
1011706151 6:90003344-90003366 CCTGGAGCAGGTGAGGGAGCTGG - Intronic
1012409279 6:98937608-98937630 CAGGGTGAAAGTGATGGAGGAGG + Intronic
1012500964 6:99887820-99887842 TAAGGAGCAAGTGAGGGAGCTGG - Intergenic
1013590449 6:111615396-111615418 CAGGGAGCAACGGAGGGCGCTGG + Intergenic
1013618186 6:111864313-111864335 CACAGAGTAAGTGACAGAGCTGG - Intronic
1013857222 6:114588325-114588347 CAGGGAGTAAGGGACAGAGCAGG - Intergenic
1015590037 6:134814345-134814367 CTGGAAGGAAGTGAGGAAGCAGG + Intergenic
1016134991 6:140530029-140530051 CAGGGGCTGAGTGAGGGAGTGGG - Intergenic
1016388551 6:143552372-143552394 CAGAGAGTCACTGAGGGAGTAGG + Intronic
1016833693 6:148456225-148456247 TAGGGGGAAAGTGAGGCAGCAGG - Intronic
1016944457 6:149515705-149515727 TAGTGGGTAAGTGAGGAAGCAGG - Intronic
1017694383 6:156999984-157000006 CATGGAGTGAGTGAGTGAGTGGG + Intronic
1018220968 6:161579138-161579160 AAGGGAGGAAGTGAAGGAGATGG + Intronic
1018341811 6:162858825-162858847 CAGGGAAGAAGTGAGGCCGCAGG + Intronic
1018343671 6:162879718-162879740 CAGTGAGTAAGACAGAGAGCAGG + Intronic
1018421209 6:163642368-163642390 CTGGGGGTTAGGGAGGGAGCGGG + Intergenic
1018454573 6:163940593-163940615 GAGGGAAAAAGAGAGGGAGCAGG + Intergenic
1018534552 6:164806643-164806665 CATGGATTGAGGGAGGGAGCTGG - Intergenic
1018630636 6:165819165-165819187 GAGGGAGCAGATGAGGGAGCAGG - Intronic
1018914902 6:168127182-168127204 GATGGCGTAAGTGGGGGAGCTGG + Intergenic
1019140203 6:169938021-169938043 CAGGGGGCAGGTGAGGGAGGAGG - Intergenic
1019164788 6:170091096-170091118 CAGGGAGCAAGGCCGGGAGCAGG - Intergenic
1019224731 6:170500489-170500511 CAGGCAGAAAGTGAGGCATCTGG - Intergenic
1019676537 7:2316788-2316810 CAGTGAGTGAGTGAGTGAGTGGG - Intronic
1019909645 7:4092069-4092091 CAGCTAGAAAGTGATGGAGCTGG - Intronic
1020245305 7:6424702-6424724 CTGGGAGTGGGTGCGGGAGCGGG - Intronic
1020339512 7:7094724-7094746 GAGGTAGTAAGAGAGGGAGGAGG - Intergenic
1020982227 7:15085189-15085211 CAGATAGTAAGTGACTGAGCTGG - Intergenic
1021099851 7:16575136-16575158 GAGGGAGGGAGGGAGGGAGCAGG + Intronic
1021764217 7:23930677-23930699 CAGGTGGTAAGTGACTGAGCTGG + Intergenic
1021786403 7:24156886-24156908 AAGGGAGTAGGGGAAGGAGCTGG - Intergenic
1022327905 7:29349423-29349445 CAGCTAGTAAGTGACAGAGCTGG + Intronic
1022366463 7:29724610-29724632 CAGGAAGGAAGGGAGGGAGGGGG - Intergenic
1023987966 7:45108901-45108923 CAGACAGCAAGTGAGAGAGCCGG + Exonic
1024270766 7:47639705-47639727 CAGGGAGTGAGTGATGGTGGAGG + Intergenic
1024270795 7:47639847-47639869 CAGGGAGTGAGTGATGGTGGAGG + Intergenic
1024550438 7:50558659-50558681 CAGCCAGTAAGTGAAGGAGTGGG + Intronic
1024692935 7:51822521-51822543 CAGAGAGTAAGTGGCAGAGCTGG - Intergenic
1025116016 7:56258919-56258941 GAGGAAGGAAGTGAGGGAGGAGG - Intergenic
1025610601 7:63072935-63072957 CAAGCAGTAAGTGTTGGAGCTGG - Intergenic
1025708904 7:63890367-63890389 CAGGCAGTGAGTGTTGGAGCTGG + Intergenic
1026015390 7:66667460-66667482 CAGGGACCAGGTGAGGGAGGAGG - Intronic
1026033964 7:66817665-66817687 CAGGGAGTAACAGGAGGAGCTGG + Intergenic
1026341030 7:69434154-69434176 CGGGGAGCAAGAGAGGGAGGAGG - Intergenic
1026891802 7:73986612-73986634 CAGGGACCAGGTGAGGGAGGAGG - Intergenic
1026985628 7:74553692-74553714 CAGGGAGTAACAGGAGGAGCTGG - Intronic
1028085744 7:86634925-86634947 CAGGGAGCAAGAGAGGTAGGGGG + Intergenic
1028516955 7:91688261-91688283 CTGGTAGAAAGTGAGGAAGCAGG + Intergenic
1029034181 7:97501375-97501397 CAGCTAGTAAGTGAGAGAGATGG - Intergenic
1029521270 7:101064200-101064222 CAGGGCGTTAGTGTTGGAGCAGG - Intergenic
1029597089 7:101543660-101543682 CAGGGTGTGAGAGAGGGACCTGG + Intronic
1029813573 7:103072713-103072735 GAGTAATTAAGTGAGGGAGCTGG - Intronic
1030133432 7:106222477-106222499 AAGGTAGTAATTGAGAGAGCAGG - Intergenic
1030913950 7:115289132-115289154 AAGAGAGTGAGTGAGGGAGGAGG + Intergenic
1031237245 7:119191820-119191842 CTGGGTGTATGAGAGGGAGCTGG + Intergenic
1031756142 7:125645408-125645430 CAGGGAGAAAGAGAGGGAGGGGG - Intergenic
1032101889 7:128986763-128986785 CAGGAAGGAATCGAGGGAGCGGG + Exonic
1032305102 7:130725760-130725782 GAGGGAGGAAGGGAGGGAGGGGG - Intergenic
1032505435 7:132431019-132431041 CAGGGAGTAAGTGCTGGAGTTGG - Intronic
1032663508 7:134012039-134012061 CATGGATGAAGTGAGTGAGCAGG + Intronic
1033024457 7:137759099-137759121 GAGGGAGTAGGAGAGGGAGGGGG - Intronic
1033105229 7:138514839-138514861 GAGCTAGTAAGTGAGGGAACTGG + Intronic
1033258232 7:139820084-139820106 CTGGGAGTGAGAGTGGGAGCAGG - Intronic
1034628293 7:152511132-152511154 CAGCTTGTAAGTGGGGGAGCTGG + Intergenic
1035023108 7:155810131-155810153 CCGGGAGTAAGTGGGGCTGCAGG + Intronic
1035236449 7:157500664-157500686 GAAGGAGAAAGTGTGGGAGCGGG - Intergenic
1035280650 7:157776180-157776202 GAGGGAGGAAGTGAAGGAGAGGG - Intronic
1035471802 7:159114836-159114858 AAGGGAGGGAGGGAGGGAGCGGG + Intronic
1035829568 8:2680205-2680227 CAGGAAGCAGGTGGGGGAGCTGG - Intergenic
1036044030 8:5119878-5119900 CAGTGAGTCAGTGAGGGAACCGG - Intergenic
1036546855 8:9779555-9779577 CAGGGAGAAAGTTCGGGACCAGG - Exonic
1036625664 8:10469439-10469461 GAGGGAGGAAGGGAGGGAGGGGG - Intergenic
1036876545 8:12478043-12478065 GAGGGAGGAAGAGAGGGAGAGGG - Intergenic
1037535175 8:19817192-19817214 CAGGGAGCATGCGCGGGAGCGGG - Exonic
1037881023 8:22573580-22573602 CCTGGAGGAAATGAGGGAGCTGG + Intronic
1037931825 8:22885527-22885549 CTCCGAGTATGTGAGGGAGCTGG + Intronic
1038394212 8:27235017-27235039 CAGGGAGTAAATGGGAGAACAGG - Intergenic
1038551993 8:28478449-28478471 CAAGGGGTAAGGGAGGGAGAGGG - Intronic
1038703689 8:29874691-29874713 CAGGCAGTAAGTGATCGAGCTGG + Intergenic
1039097569 8:33903258-33903280 CAGGTAGTAAGTGGAAGAGCTGG + Intergenic
1039114006 8:34072108-34072130 CGGGGAGTTAGTGGGGGGGCGGG - Intergenic
1039468856 8:37801506-37801528 CTGGGAGTGAGTGAGGGGGAAGG + Intronic
1039752383 8:40490273-40490295 AAGAGAGGAAGTGAAGGAGCAGG + Intergenic
1039948707 8:42151961-42151983 CAGGTTGTAAGTGTTGGAGCGGG + Intergenic
1040894314 8:52349964-52349986 CAGGGAGAAACAGAGGGATCAGG + Intronic
1040917374 8:52577016-52577038 CAGCTATTAAGTGATGGAGCTGG - Intergenic
1042036587 8:64540450-64540472 GAGGGAGGGAGGGAGGGAGCTGG + Intergenic
1042612610 8:70615037-70615059 AAGGGAGCCAGTGAGGGAGCTGG + Intronic
1044612012 8:94100920-94100942 CAGCTAGTAAGTGGTGGAGCTGG + Intergenic
1044868530 8:96596189-96596211 TAGTGAGAAAGTGAGGGAGTTGG + Intronic
1045187953 8:99857505-99857527 CAAAGAGTAGGCGAGGGAGCTGG - Intronic
1045330883 8:101154842-101154864 CAGGGAAGGAGTGAGGGAGGGGG + Intergenic
1045704476 8:104905058-104905080 CAGGGATTAAGTGTTGGAGAGGG - Intronic
1045845794 8:106634516-106634538 CAAGTAGTAAGTGATGGAGGTGG + Intronic
1046106092 8:109668113-109668135 AAGGGAATAAGGGAGGGAGGGGG + Intronic
1046776278 8:118167291-118167313 CAGGGAGCATGTGGTGGAGCAGG - Intergenic
1047872082 8:129095258-129095280 GAGGGAGGAAGAGAGGGAGGAGG - Intergenic
1048134013 8:131728380-131728402 CAAGCAGCAAGGGAGGGAGCTGG + Intergenic
1048411124 8:134174135-134174157 CAGGAAGTTAGTGGCGGAGCTGG - Intergenic
1048574339 8:135679245-135679267 AAGTGAGTAAGTGTCGGAGCAGG + Intergenic
1048618857 8:136109390-136109412 AAAGGAGTAAGAGAGAGAGCAGG - Intergenic
1048752754 8:137698268-137698290 CAGGGAGGAGGAGAGGGAGGTGG + Intergenic
1049018242 8:139936650-139936672 CAGGGAGAGAATGGGGGAGCGGG + Intronic
1049067446 8:140328580-140328602 CAGGGGGAAAGGGTGGGAGCAGG + Intronic
1049202144 8:141345687-141345709 CAGGAAGGAAGTGAGACAGCTGG + Intergenic
1049358160 8:142198922-142198944 CAGGCTGTTAGTGAGGGGGCAGG - Intergenic
1049578008 8:143398432-143398454 CAGGGAGGAAGTGTGGGAGGAGG + Intergenic
1049807570 8:144547891-144547913 CAAGGAGTACGTGCGGCAGCTGG - Exonic
1050012602 9:1200309-1200331 CAGCTAGTAAGTGACAGAGCTGG - Intergenic
1051191063 9:14513764-14513786 AAGAGAGTAAGTGATGGAACTGG - Intergenic
1051680481 9:19602708-19602730 CAGGTAGAAACTGATGGAGCTGG - Intronic
1051735848 9:20198478-20198500 CACGGAGTAAGTCAGGGAAAGGG - Intergenic
1052735593 9:32339134-32339156 GAGGGAGAAAGAGAGAGAGCAGG - Intergenic
1052735602 9:32339238-32339260 GAGGGAGAAAGCGAGGGAGAGGG - Intergenic
1052794828 9:32913855-32913877 CAGGGAGCAAGAGTGGAAGCAGG - Intergenic
1053065639 9:35066959-35066981 CAGGGTGGAAGTGAGGGCGAAGG + Intronic
1053316407 9:37055535-37055557 CAGCTAGTAAGTGCGAGAGCTGG - Intergenic
1053918356 9:42962796-42962818 CAGGGAGTAAGAGAGAGAAGGGG - Intergenic
1054778048 9:69140388-69140410 CAGCTAGTCAGTGATGGAGCTGG + Intronic
1055437507 9:76307308-76307330 AAGGGAGAAAGGGAGGGAGGAGG + Intronic
1056626404 9:88257208-88257230 GAGGCAGTAAGTGCTGGAGCGGG + Intergenic
1057483011 9:95460604-95460626 CAGGGAGAGAGTGAGAGAACTGG + Intronic
1057565030 9:96159977-96159999 GAGGGAGGAAGGGAGGGAGGGGG + Intergenic
1057874724 9:98745233-98745255 CAGTGAATAAGTGAAGGAGCTGG + Intronic
1057978731 9:99635987-99636009 CAGGGGGTCAGAGAGGGAGTTGG + Intergenic
1058195871 9:101974799-101974821 CAGCTAGTAAGTGGTGGAGCTGG - Intergenic
1058246667 9:102634340-102634362 CAGAGAGGAAGAGAGAGAGCAGG - Intergenic
1058382557 9:104393759-104393781 CAGCAAGTAAGTGAAGGAGCAGG + Intergenic
1058640326 9:107077698-107077720 CAGGGAGAAAGTGGGAGAGGGGG - Intergenic
1058651372 9:107178113-107178135 CAGGCAGTCAGTGGTGGAGCTGG + Intergenic
1058752382 9:108052002-108052024 GAGGGAGAGAGTGTGGGAGCCGG + Intergenic
1059084473 9:111285210-111285232 CGGGGGTTAAGAGAGGGAGCAGG - Intergenic
1059262880 9:112995463-112995485 CAGGGAGGAAGGGAGAGAGAGGG - Intergenic
1059384138 9:113950867-113950889 CAGGCAGTGAGTGTGGAAGCAGG + Intronic
1059395916 9:114033989-114034011 CAGCTAGTAAGTGGTGGAGCTGG - Intronic
1059423998 9:114209558-114209580 CAGGGAGGAAGAGGAGGAGCCGG + Intronic
1059462491 9:114442683-114442705 GAGGGAGCAAGAGAGAGAGCAGG - Intronic
1059669331 9:116478093-116478115 CAGGAAGAAAGAGAGGGAGGGGG + Intronic
1060085104 9:120691717-120691739 CAGGGAGTAAGTGATGGAGCTGG + Intronic
1060232267 9:121834385-121834407 CAGGCAGTAAGTGGGAGAGCTGG - Intronic
1060268977 9:122128030-122128052 CAGGGAGGCACTGAGGGGGCTGG - Intergenic
1060316014 9:122511262-122511284 AAGGGTGTGAGAGAGGGAGCTGG - Exonic
1060338133 9:122746206-122746228 CAGGGAGTAAGTGGTAGAGCTGG - Intergenic
1060413349 9:123414133-123414155 CAGGGAGTAAATGGGAGAACTGG - Intronic
1060856679 9:126919499-126919521 CAGCCAGTAAGTGACAGAGCTGG - Intronic
1060934160 9:127506133-127506155 CTGGGAGTGAGTGAGTGAGATGG - Exonic
1060961854 9:127686424-127686446 CAGAGAGTGAGAGAGTGAGCAGG - Intronic
1061000592 9:127899956-127899978 CAGGGTGCAAGGCAGGGAGCTGG - Intronic
1061017966 9:127993615-127993637 CAGGGAGTAAGTGTTAAAGCAGG + Intergenic
1061073741 9:128328136-128328158 CAGGGAGACAGTGAGTGGGCTGG + Intronic
1061187184 9:129061360-129061382 GAGGGAGGGAGGGAGGGAGCAGG + Intronic
1061567070 9:131447949-131447971 CAGGGAGTAAATGAGGAAGGAGG - Intronic
1062201700 9:135306213-135306235 GAGGGAGGAAGGGAGGGAGGGGG - Intergenic
1062361669 9:136191194-136191216 CAGAGCGTAAGTGCGGGAGGTGG - Intergenic
1062464989 9:136676948-136676970 CAGGGAGAACGTGAGTGTGCAGG - Exonic
1062612661 9:137382018-137382040 CGGGGAGGAGGTGAGGGCGCGGG + Intronic
1062612697 9:137382130-137382152 CGGGGAGGAGGTGAGGGCGCGGG + Intronic
1185446848 X:262569-262591 CAGGGAGGGAGCTAGGGAGCTGG - Intergenic
1185683783 X:1910428-1910450 GAGGGAGAAAGTGAGGAAGGGGG - Intergenic
1186092862 X:6068364-6068386 CAGGGGGCAAGAGAGGGAGAGGG + Intronic
1186276896 X:7949032-7949054 CAGGTATTAAGGGAGGGACCTGG + Intergenic
1186685131 X:11917736-11917758 GAGGGAGGAAGGGAGGGAGGAGG + Intergenic
1187003122 X:15202613-15202635 CAGCTAATAAGTGATGGAGCTGG + Intergenic
1187124688 X:16444237-16444259 CAGCTAGTAAGTGATGGAGCTGG + Intergenic
1187275826 X:17816068-17816090 GAGGGAGTAAGTGGGGGTGGGGG - Intronic
1188237182 X:27744799-27744821 CACGTGGTAAGAGAGGGAGCAGG - Intronic
1188388587 X:29591852-29591874 CAGGGAGTAAGTGAAGGTCCAGG + Intronic
1189141931 X:38616304-38616326 CAGCTAGTAAGTGGTGGAGCTGG + Intronic
1189220596 X:39368536-39368558 CAGGTAGTAAGTGGTGGAGGAGG + Intergenic
1189409832 X:40760412-40760434 CAGGAAGCATGTGAGAGAGCAGG + Intergenic
1189514093 X:41693751-41693773 GAGGGAGAAAGGAAGGGAGCGGG - Intronic
1189974567 X:46448260-46448282 CTGAGACTAAGTGAGGAAGCTGG - Exonic
1190003544 X:46712367-46712389 GAGGGAGCAAGTGAGAGAGTGGG + Intronic
1190310005 X:49110535-49110557 AGGGGAGTAAGTGAGGGAGAAGG - Intergenic
1190624476 X:52323616-52323638 CAGTTAGTAAGTGATGGAGCTGG - Intergenic
1190787097 X:53662268-53662290 CAGTGAGTAAGTGATATAGCAGG - Intronic
1190974355 X:55385257-55385279 CCTGGAGGAAGTGAGGAAGCAGG + Intergenic
1191226850 X:58053221-58053243 CAAGGAGAAAGAGAGGGAGAGGG - Intergenic
1191979329 X:66908684-66908706 CATGCAGTAAGTGGTGGAGCAGG - Intergenic
1192162100 X:68796142-68796164 GAGGGAGCAACTGAGGGAGATGG - Intergenic
1192608621 X:72545498-72545520 GAGGTAGTAATTGATGGAGCTGG + Intronic
1194808897 X:98365508-98365530 CTGGGAGTAATTGGGAGAGCTGG + Intergenic
1194853806 X:98903308-98903330 CAGCTAGTAAGAGTGGGAGCTGG - Intergenic
1195916361 X:109940049-109940071 TTGGGAGTAACTGAGTGAGCTGG + Intergenic
1196003322 X:110809276-110809298 CAGAGAGTCAGTGAGGAACCTGG - Intergenic
1196006377 X:110841790-110841812 CAGGGAGTCAGAGAAGGAGAAGG - Intergenic
1196236152 X:113283119-113283141 CAGATAGTCAGTGATGGAGCTGG + Intergenic
1196510998 X:116512208-116512230 CAGAGAATGAGTGAGGGAGGAGG + Intergenic
1197262347 X:124332741-124332763 CAGGGAGTGAGGGAGGAAGGAGG + Intronic
1198006476 X:132499627-132499649 CAGCTAGTAAGTGACAGAGCAGG - Intergenic
1198428228 X:136540863-136540885 CTGTTAGTAAGTGATGGAGCTGG - Intronic
1199458205 X:148053181-148053203 CAGGGAGGGAGGGAGGGAGGAGG - Intergenic
1199538009 X:148925634-148925656 CAGTGAGGAAGTGACAGAGCTGG - Intronic
1199983124 X:152932017-152932039 CAGGGAGCCAGTTAGAGAGCAGG + Intronic
1200069671 X:153521935-153521957 CAGGGAGTGGGTGTGGGAGGTGG - Intronic
1201146413 Y:11067478-11067500 GAGGGAGGAAGAGAGGGAGAGGG + Intergenic
1201625602 Y:16011728-16011750 AAGGGAGAAAGTGAGAGAGGAGG + Intergenic
1201860176 Y:18588891-18588913 CAGGGAGTAACTGAGTAAACAGG - Intronic
1201873145 Y:18731490-18731512 CAGGGAGTAACTGAGTAAACAGG + Intronic
1201950339 Y:19556776-19556798 CAGGGAGAAAGTGAGGGCTCAGG + Intergenic
1202166690 Y:21996659-21996681 CAGTGAGTAACTGAGTAAGCAGG + Intergenic
1202224669 Y:22589714-22589736 CAGTGAGTAACTGAGTAAGCAGG - Intergenic
1202318445 Y:23605946-23605968 CAGTGAGTAACTGAGTAAGCAGG + Intergenic
1202552322 Y:26064111-26064133 CAGTGAGTAACTGAGTAAGCAGG - Intergenic