ID: 1166181331

View in Genome Browser
Species Human (GRCh38)
Location 19:41111375-41111397
Sequence TCCTCCAGTTGGCGATGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166181328_1166181331 14 Left 1166181328 19:41111338-41111360 CCTTCACAGGAACTATGACACAG No data
Right 1166181331 19:41111375-41111397 TCCTCCAGTTGGCGATGGAATGG No data
1166181327_1166181331 25 Left 1166181327 19:41111327-41111349 CCATCTACACACCTTCACAGGAA No data
Right 1166181331 19:41111375-41111397 TCCTCCAGTTGGCGATGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166181331 Original CRISPR TCCTCCAGTTGGCGATGGAA TGG Intergenic
No off target data available for this crispr