ID: 1166181394

View in Genome Browser
Species Human (GRCh38)
Location 19:41111729-41111751
Sequence TCAACCCAGTTGAGAACCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166181394_1166181395 -6 Left 1166181394 19:41111729-41111751 CCAGCGGTTCTCAACTGGGTTGA No data
Right 1166181395 19:41111746-41111768 GGTTGATTTTTTTCCTCCCAAGG No data
1166181394_1166181396 -5 Left 1166181394 19:41111729-41111751 CCAGCGGTTCTCAACTGGGTTGA No data
Right 1166181396 19:41111747-41111769 GTTGATTTTTTTCCTCCCAAGGG No data
1166181394_1166181401 14 Left 1166181394 19:41111729-41111751 CCAGCGGTTCTCAACTGGGTTGA No data
Right 1166181401 19:41111766-41111788 AGGGGACATTCAATAGTATCTGG No data
1166181394_1166181397 -4 Left 1166181394 19:41111729-41111751 CCAGCGGTTCTCAACTGGGTTGA No data
Right 1166181397 19:41111748-41111770 TTGATTTTTTTCCTCCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166181394 Original CRISPR TCAACCCAGTTGAGAACCGC TGG (reversed) Intergenic
No off target data available for this crispr