ID: 1166183944

View in Genome Browser
Species Human (GRCh38)
Location 19:41127289-41127311
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166183944_1166183951 29 Left 1166183944 19:41127289-41127311 CCTGTGTTTACCATTCACAGCAG 0: 2
1: 0
2: 0
3: 8
4: 127
Right 1166183951 19:41127341-41127363 TTTATTTTTCTTTCTGAGACAGG 0: 2
1: 49
2: 1414
3: 18141
4: 28790
1166183944_1166183952 30 Left 1166183944 19:41127289-41127311 CCTGTGTTTACCATTCACAGCAG 0: 2
1: 0
2: 0
3: 8
4: 127
Right 1166183952 19:41127342-41127364 TTATTTTTCTTTCTGAGACAGGG 0: 2
1: 73
2: 1522
3: 18910
4: 29630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166183944 Original CRISPR CTGCTGTGAATGGTAAACAC AGG (reversed) Intronic
903917007 1:26771964-26771986 CTGCTGGGAATGGTAACTATTGG + Intronic
909080218 1:71101912-71101934 CTGCTGAGAAAGGTTAACATAGG - Intergenic
910457382 1:87412142-87412164 CTGGTGTGAGGGGAAAACACTGG + Intergenic
912163892 1:107019549-107019571 CTGATGTATATGGTAAATACTGG + Intergenic
916476178 1:165171149-165171171 CTGCTATGAATGGTCAATAAAGG - Intergenic
917476796 1:175375669-175375691 CTGCAGGGAATGGCAAATACAGG + Intronic
917951647 1:180044403-180044425 CTGCTGTGAATATTAAATGCAGG - Intronic
918702261 1:187620080-187620102 CTGCTGTGAATGTGAGGCACAGG - Intergenic
919562131 1:199134958-199134980 CTGCTGTGAATGCAGAATACTGG - Intergenic
923305246 1:232682398-232682420 GTGCTGTAGGTGGTAAACACAGG + Intergenic
924684813 1:246278157-246278179 GTGCTGTGAATGTGAAACCCAGG + Intronic
1063609493 10:7551274-7551296 CTGCTGTGAACTGTGAACACGGG + Intergenic
1063691557 10:8292527-8292549 TTGCCCTGAATGGTCAACACTGG - Intergenic
1065437965 10:25721091-25721113 CTGATGTGAAGGGGAAAAACTGG - Intergenic
1066449031 10:35511351-35511373 GTGCTGTGGAGGGTGAACACGGG + Intronic
1068698973 10:60000059-60000081 CTGCTGTGAATGGTGACACCAGG + Intergenic
1068782667 10:60938440-60938462 CTCATGTGGATGGAAAACACTGG - Intronic
1071018658 10:81027493-81027515 ATGCTGTGAAAGAGAAACACTGG + Intergenic
1073407732 10:103312535-103312557 CTGCTGTGAGTGGCACACATAGG - Intronic
1073608627 10:104921232-104921254 CTGCTGTGCTTTGTAAAAACAGG + Intronic
1073719964 10:106157355-106157377 GTGGTGTGAATGGTAAACCCAGG - Intergenic
1075452645 10:122562756-122562778 CACCTCTGAATGGCAAACACAGG - Intronic
1075837864 10:125471332-125471354 CTACTATGAATGGTAATGACAGG + Intergenic
1077958234 11:7044392-7044414 CTGCTGAACCTGGTAAACACAGG + Intronic
1080229357 11:30001214-30001236 CAGCAGTGAATGGAAAACTCAGG + Intergenic
1082963645 11:58943247-58943269 CTGCTGGGATTGGCCAACACTGG - Exonic
1091039097 11:132260069-132260091 CTTTTGTGAATGGGAAACAAGGG + Intronic
1092731961 12:11543190-11543212 CTGCACAGAATAGTAAACACTGG - Intergenic
1098580677 12:72095243-72095265 CTGCTGAGAATGGCAATAACAGG - Intronic
1099644262 12:85330712-85330734 CTTGTGTGAAGGGTACACACAGG + Intergenic
1100319498 12:93476704-93476726 CTGTTAGGAATGGTAAACATTGG - Intronic
1102496789 12:113325198-113325220 CTGCTGTGAATGCAGAAAACTGG - Intronic
1104344360 12:127982667-127982689 CTTCTGTCAATGATAGACACTGG + Intergenic
1107441443 13:40430861-40430883 GTGATGTGAATGGTAAACCCAGG - Intergenic
1107682717 13:42867815-42867837 GTGCTGTCAGTGGAAAACACCGG + Intergenic
1108521053 13:51247240-51247262 CTGCTGTGAAAGGGATACAGTGG + Intronic
1109649490 13:65308065-65308087 CTGCTTTTACTGGTAAACATTGG + Intergenic
1111809945 13:93087874-93087896 ATGCTGAGATTGGGAAACACAGG + Intergenic
1112365299 13:98751361-98751383 CTGCTGGAAATGCTAAACACGGG + Intronic
1113441725 13:110334288-110334310 CTGCTGTGCTTGATAAACAAAGG - Intronic
1121774393 14:96581044-96581066 CTGCTGTGAGTTGTGAAAACCGG - Intergenic
1121805219 14:96813182-96813204 TTGCTGTGAATTGTGAACAAGGG + Intronic
1125101069 15:35913251-35913273 CTTCTTTTAATGGTACACACAGG - Intergenic
1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG + Intronic
1127982169 15:64043193-64043215 CTGCTGGGAGGGGTATACACTGG + Intronic
1128251398 15:66166511-66166533 CGGTTGTGAATGGAAGACACTGG - Intronic
1134239077 16:12491402-12491424 CTGTTGTGAATGTGAAACAATGG - Intronic
1134399351 16:13894668-13894690 CAGCTGTGAAGGGCAAATACGGG - Intergenic
1135550312 16:23392601-23392623 CTGATCTCAATGGCAAACACAGG + Intronic
1137516065 16:49145548-49145570 TTGCTGTGAAAGGTATAGACTGG + Intergenic
1142430893 16:90026614-90026636 CTGCTGTGGATGCAAAACAGAGG - Intronic
1142881977 17:2889023-2889045 CTGTTGTGAGCAGTAAACACAGG + Intronic
1143745613 17:8991970-8991992 GTGCTGTGAGTGGTACCCACTGG - Intergenic
1148042849 17:44722550-44722572 CTGCAGTGAATAGTAAACTAGGG - Intronic
1148579710 17:48735093-48735115 CTTCTGTGCAAGGTGAACACTGG - Intergenic
1149157794 17:53653933-53653955 ATGATGTGATTGGAAAACACAGG - Intergenic
1149217364 17:54373235-54373257 TTGCTGTGTATGGAAAACAAGGG + Intergenic
1149828841 17:59853644-59853666 CTGCTGGGAATTGTAGAAACTGG - Intergenic
1152295904 17:79466762-79466784 CTGGTTTGAGTGGTAAACTCAGG + Intronic
1153809235 18:8737393-8737415 CAGCTGTGAATTTTAAATACAGG - Intronic
1164959496 19:32415468-32415490 GTACTGGGAATGGTAAACAGAGG + Intronic
1166143607 19:40819490-40819512 CTGCTGTGAATGGTAAACACAGG + Intronic
1166183944 19:41127289-41127311 CTGCTGTGAATGGTAAACACAGG - Intronic
925290791 2:2747418-2747440 ATGCTGTGACTGGTAAGCAAAGG + Intergenic
925537579 2:4933964-4933986 TTTCTTTGAATGGTAAAGACTGG - Intergenic
929092575 2:38234014-38234036 CTGCAGTGAATGCCAAATACAGG - Intergenic
931603310 2:64026049-64026071 CTATTTTGAATGGAAAACACAGG + Intergenic
932080161 2:68706965-68706987 TTGCTGTGAAGGGAATACACTGG - Intronic
932914913 2:75846685-75846707 CTTCTTTGAATGGAAAACAGGGG + Intergenic
947169575 2:227297987-227298009 CTGCTGGGTATGGGAACCACAGG - Intronic
947538855 2:230960695-230960717 CTGCAGAGAATGGTAGTCACAGG + Intronic
1172150821 20:32789154-32789176 CTGCTGTAGCTGGTTAACACAGG - Intronic
1174066649 20:47870630-47870652 CTGCTTTCAATGGCACACACAGG - Intergenic
1182756938 22:32687930-32687952 TTGCTGTGAAGGGGAATCACAGG - Intronic
1182854081 22:33501858-33501880 GTGCTATGAAGGGGAAACACAGG + Intronic
1185188178 22:49415737-49415759 CAGCTGTAAAAGGCAAACACAGG - Intronic
950912209 3:16605987-16606009 CTGCTGTACCTGGTAATCACAGG - Intronic
951260016 3:20496183-20496205 CTGCTGTGACAGGGAAGCACTGG + Intergenic
955598858 3:60622490-60622512 CTGATGTGAATTGTATCCACAGG + Intronic
961793541 3:129393599-129393621 CTGCTCTGAGTGCTAAACACAGG - Intergenic
962408314 3:135118986-135119008 CTGCTGTGAAGAGTGTACACTGG - Intronic
962890549 3:139668640-139668662 TTTCTGTGAATGGTCAACAAAGG - Intronic
964407948 3:156369169-156369191 CTTCTGTGAATTTTAAGCACAGG - Intronic
964890931 3:161533557-161533579 CTGCTTTGAATGGAAAAAAATGG - Intergenic
969177849 4:5412824-5412846 CTGCTGTGAATGGATTACAGGGG - Intronic
970277226 4:14414519-14414541 CTGCTGGTGATGGTATACACTGG - Intergenic
970903531 4:21188247-21188269 CTGGAGTGAAGGATAAACACAGG + Intronic
971600505 4:28585716-28585738 ATGCTGAGAAAGGTAAAAACAGG - Intergenic
972286155 4:37650529-37650551 ATGCTGTGGAAGGAAAACACGGG + Intronic
974481437 4:62448659-62448681 CACCTGTGAATGGTGAAGACAGG - Intergenic
976145986 4:82043514-82043536 CTTCTGTGAATGAGATACACTGG - Intronic
976797247 4:88948074-88948096 TTACTATGAATGTTAAACACTGG + Intronic
977821581 4:101478160-101478182 CTGCTGTGAATGTCCAATACTGG + Intronic
977922547 4:102661355-102661377 CTGCTGTCAAAGGGAAACATGGG - Intronic
979338957 4:119497445-119497467 TGGATGTGAATGCTAAACACTGG - Exonic
980042435 4:127954660-127954682 CTTCTGTGAATGTGAATCACAGG + Intronic
981587188 4:146316688-146316710 CTGCTGGCCATGGTAAACATTGG + Intronic
983897084 4:173092674-173092696 GGGCTGGGAATGGTAAACACTGG + Intergenic
984254249 4:177371499-177371521 CTTCTGAAAATGGTAAACACTGG + Intergenic
986751106 5:10788550-10788572 CTGCTGTCCATGCTAAGCACAGG + Intergenic
987365157 5:17141989-17142011 TGGCTGTGAATGGTGAAGACTGG - Intronic
992409451 5:76491213-76491235 CTTCTCTGAATGGTTAGCACTGG + Intronic
992776500 5:80093764-80093786 CTGCGGTGCATGGACAACACAGG - Intergenic
994192054 5:96879725-96879747 CCTCTGTGAATGTTAAACATTGG - Exonic
995101065 5:108306266-108306288 ATGCTGTGAATGAGAAACGCTGG + Intronic
1003253638 6:4455548-4455570 CTGCTGTGCTTGGGAAACCCTGG - Intergenic
1005388375 6:25308822-25308844 CTTCTTTGAATGGTTAACATGGG + Intronic
1007874491 6:45080487-45080509 CTATTGTGACTAGTAAACACGGG - Intronic
1009549816 6:65074776-65074798 CTGCTGAGACAGGTAAAGACAGG + Intronic
1010984836 6:82411881-82411903 ATGCTGTGTATGGCTAACACTGG + Intergenic
1016151236 6:140745389-140745411 CTGCCCTGAAGGGTAAATACTGG + Intergenic
1017183500 6:151576993-151577015 CTACTGAGAATTGCAAACACAGG - Intronic
1024785627 7:52903946-52903968 CTGGAGTGAATGGCAAACAATGG + Intergenic
1028616466 7:92773464-92773486 CTGCTCTGCATGCTGAACACAGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1032778880 7:135145727-135145749 CTGCTGTAAATGGTATTTACAGG + Intronic
1034071191 7:148187379-148187401 CTGATTTGCAGGGTAAACACAGG + Intronic
1035610360 8:958329-958351 CTGTTGTGAATAGTCAACAGTGG + Intergenic
1039835948 8:41256461-41256483 CAGCTATGAATGAGAAACACAGG - Intergenic
1039985753 8:42446346-42446368 CTGCTGTCAATGGTGACAACAGG + Intronic
1041571369 8:59340687-59340709 CTGCTGCAAATGGTAAACCATGG - Intergenic
1042212003 8:66390189-66390211 TTGGTGTGAATAGAAAACACTGG + Intergenic
1043376353 8:79654127-79654149 GTACAGTGAATGGTAATCACTGG - Intronic
1049148788 8:141021099-141021121 CCGCTGTGAATGGCACACATGGG - Intergenic
1049505227 8:142992649-142992671 CTGCTGGCAATGGCAACCACCGG - Intergenic
1054911190 9:70456689-70456711 CTGGTGTGAAGTGAAAACACAGG - Intergenic
1055901383 9:81242356-81242378 CAGCTGTGAATGTCACACACAGG - Intergenic
1058758364 9:108104791-108104813 CTGCTGTGACTGGTATAAATGGG - Intergenic
1062642165 9:137524706-137524728 CTGGTGAGAATGCAAAACACAGG - Intronic
1189416267 X:40816941-40816963 CTCTAGTGAATGGGAAACACGGG - Intergenic
1190751783 X:53368286-53368308 CTGCTGTGAATTGTGCACAAGGG - Intergenic
1190804391 X:53821061-53821083 CTGCTGTAAATTGTACACAAAGG - Intergenic
1197952986 X:131917889-131917911 CTTCTGTGTATGGTGGACACTGG - Intergenic
1198449471 X:136752518-136752540 CTGCTGTGACTGGTTAACTCAGG - Intronic
1200048867 X:153417872-153417894 CTGTTGTGAATGCCAATCACTGG - Intergenic
1200145937 X:153926579-153926601 CCGCTGTGAATGGTACAGTCTGG - Intronic
1200286194 X:154824879-154824901 CTGCAGCTAATGGTATACACAGG + Intronic