ID: 1166185519

View in Genome Browser
Species Human (GRCh38)
Location 19:41136488-41136510
Sequence CACAAGGGAGAGATTGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166185519_1166185528 25 Left 1166185519 19:41136488-41136510 CCGGCCACAATCTCTCCCTTGTG No data
Right 1166185528 19:41136536-41136558 GTACACAGACGTACCTACAATGG No data
1166185519_1166185529 26 Left 1166185519 19:41136488-41136510 CCGGCCACAATCTCTCCCTTGTG No data
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166185519 Original CRISPR CACAAGGGAGAGATTGTGGC CGG (reversed) Intergenic
No off target data available for this crispr