ID: 1166185520

View in Genome Browser
Species Human (GRCh38)
Location 19:41136492-41136514
Sequence GACGCACAAGGGAGAGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166185520_1166185529 22 Left 1166185520 19:41136492-41136514 CCACAATCTCTCCCTTGTGCGTC No data
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data
1166185520_1166185528 21 Left 1166185520 19:41136492-41136514 CCACAATCTCTCCCTTGTGCGTC No data
Right 1166185528 19:41136536-41136558 GTACACAGACGTACCTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166185520 Original CRISPR GACGCACAAGGGAGAGATTG TGG (reversed) Intergenic
No off target data available for this crispr