ID: 1166185521

View in Genome Browser
Species Human (GRCh38)
Location 19:41136503-41136525
Sequence GCATAAGGCTGGACGCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166185521_1166185528 10 Left 1166185521 19:41136503-41136525 CCCTTGTGCGTCCAGCCTTATGC No data
Right 1166185528 19:41136536-41136558 GTACACAGACGTACCTACAATGG No data
1166185521_1166185529 11 Left 1166185521 19:41136503-41136525 CCCTTGTGCGTCCAGCCTTATGC No data
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data
1166185521_1166185531 27 Left 1166185521 19:41136503-41136525 CCCTTGTGCGTCCAGCCTTATGC No data
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166185521 Original CRISPR GCATAAGGCTGGACGCACAA GGG (reversed) Intergenic
No off target data available for this crispr