ID: 1166185523

View in Genome Browser
Species Human (GRCh38)
Location 19:41136514-41136536
Sequence CTCGGGATTTGGCATAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166185523_1166185529 0 Left 1166185523 19:41136514-41136536 CCAGCCTTATGCCAAATCCCGAG 0: 2
1: 0
2: 0
3: 8
4: 68
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data
1166185523_1166185531 16 Left 1166185523 19:41136514-41136536 CCAGCCTTATGCCAAATCCCGAG 0: 2
1: 0
2: 0
3: 8
4: 68
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data
1166185523_1166185528 -1 Left 1166185523 19:41136514-41136536 CCAGCCTTATGCCAAATCCCGAG 0: 2
1: 0
2: 0
3: 8
4: 68
Right 1166185528 19:41136536-41136558 GTACACAGACGTACCTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166185523 Original CRISPR CTCGGGATTTGGCATAAGGC TGG (reversed) Intergenic
904313249 1:29642869-29642891 CTCAGGATTTGGCAGAGTGCAGG - Intergenic
906935086 1:50207766-50207788 CTCAGTATCTGGCATATGGCAGG - Intergenic
918668086 1:187177607-187177629 CTTGGGCTTTGGGTTAAGGCTGG - Intergenic
920630149 1:207644846-207644868 CTTGGTATTTGGCATTAGTCAGG - Intergenic
920640905 1:207751602-207751624 CTTGGTATTTGGCATTAGTCAGG - Intergenic
921773830 1:219074038-219074060 CTCGTCATTTAGCATAAGGGAGG - Intergenic
922959705 1:229635984-229636006 GTCGGAGTTTGGCATAAGTCTGG - Exonic
923559006 1:235024235-235024257 CAAGGGCTTTGGCATAAGACAGG - Intergenic
1062850768 10:740812-740834 CTGGGGATTTTGCTTAAAGCAGG - Intergenic
1072629363 10:97134831-97134853 CGCGGGCTTTGCCATCAGGCAGG + Intronic
1074535641 10:114326745-114326767 CTCTGGACTTGGCATAAGAAGGG + Intronic
1077143058 11:1033336-1033358 CTCGGGGTTCGGCAGATGGCGGG + Intronic
1080212814 11:29806677-29806699 CTCAGGATTTAGCTTGAGGCAGG + Intergenic
1080911871 11:36608983-36609005 CTCAGGATGTGGCATAGAGCTGG - Intronic
1083889378 11:65588369-65588391 CTGAGGCTTTGGCATGAGGCTGG + Intronic
1099772008 12:87072762-87072784 CTCTGGATTTGGTATAACGCAGG + Intergenic
1100318756 12:93469888-93469910 CTTGGGATTTGGCTGAGGGCAGG + Intronic
1103989103 12:124786361-124786383 CTCCGGATTTGGCAGATGACAGG + Exonic
1104728086 12:131089827-131089849 TTCGGGATTTGGCTCAAGGCTGG - Intronic
1105793631 13:23829140-23829162 TTCTGGGTTTGGCATAAGGCGGG - Intronic
1116272445 14:42788924-42788946 TTCAGGGTTTGGCAAAAGGCAGG + Intergenic
1117274318 14:54177255-54177277 TTCCGAATTTGGCAGAAGGCAGG - Intergenic
1119214568 14:72858652-72858674 CTTTGGCTTTTGCATAAGGCAGG - Intronic
1121835576 14:97089066-97089088 CTGGGGATTTGTCAAAAGGCAGG - Intergenic
1128407415 15:67357100-67357122 CTAGGCAGTTTGCATAAGGCGGG + Intronic
1142385940 16:89764765-89764787 CTCGGGACGTGGCATGATGCAGG + Intronic
1143266775 17:5643992-5644014 CTGCCTATTTGGCATAAGGCGGG + Intergenic
1143349991 17:6280797-6280819 GATGGGATTTGGCCTAAGGCAGG - Intergenic
1148092838 17:45032938-45032960 CTTGGGATCTGGCAAGAGGCTGG - Intronic
1152017929 17:77764127-77764149 CTCAGCATCTGGCACAAGGCAGG + Intergenic
1153366628 18:4264594-4264616 GTCGGGATTTGGCTCAAGGCAGG - Intronic
1163098654 19:15079996-15080018 CTGGGAAATTGGTATAAGGCAGG - Intergenic
1166142002 19:40810279-40810301 CTCGGGATTTGGCATAAGGCTGG + Intronic
1166185523 19:41136514-41136536 CTCGGGATTTGGCATAAGGCTGG - Intergenic
937329376 2:121016332-121016354 CTTGGGTTTTGACGTAAGGCAGG - Intergenic
946367712 2:219259970-219259992 CTTTGGATTTGGCAAGAGGCAGG - Intronic
1169487827 20:6048096-6048118 CACGGGATTTGGCAAAATGTGGG - Intronic
1174582524 20:51582174-51582196 CTCTGGATTAGGAATAAGGATGG - Intergenic
1174876053 20:54227460-54227482 CTGGGGAACTGGCATAAGGCTGG - Intronic
1179369042 21:40786982-40787004 CTTGGGCTTTGGAATCAGGCAGG - Intronic
1179662495 21:42885904-42885926 CTGGGGATTTGGCACTAGCCTGG - Intronic
1180782539 22:18529161-18529183 CTGGGGGTGTGGCTTAAGGCAGG + Intronic
1181126091 22:20703190-20703212 CTGGGGGTGTGGCTTAAGGCAGG + Intergenic
1181239430 22:21468499-21468521 CTGGGGGTGTGGCTTAAGGCAGG + Intergenic
1182965229 22:34515074-34515096 CTCGGGTTTTGGGAGAAGGAAGG + Intergenic
949387712 3:3522304-3522326 CTCGGGACTTAGCAAAATGCTGG + Intergenic
949571614 3:5299438-5299460 CTTGGTTTTTGGAATAAGGCTGG + Intergenic
953065412 3:39465197-39465219 CTCAGAATTTGGAATGAGGCCGG - Intergenic
953487157 3:43311419-43311441 CTAGGGATTTGGGAAAAGGGAGG + Intronic
961151026 3:124637936-124637958 TTGGGGTTTTGGCATAATGCTGG + Intronic
963936053 3:151054758-151054780 TACTGGATTTGGCATAAGGGAGG + Intergenic
965698223 3:171431857-171431879 CTTGGGATTTGCCAAAAGGCAGG - Intronic
965942944 3:174207367-174207389 CACAGGATTTGGCATAAAGTAGG + Intronic
969315939 4:6381317-6381339 CTCGGGACTTGGCACAGGCCTGG + Intronic
970521575 4:16889997-16890019 GTTGGGATTTGGCATAGTGCTGG - Intronic
975282043 4:72572063-72572085 GAAGGGATTTGACATAAGGCAGG - Intergenic
976692146 4:87880313-87880335 CTCGGGAAGTGGCATTGGGCAGG + Intergenic
997485525 5:134227136-134227158 CTCCGGATCTGGCATATAGCTGG - Intergenic
998811163 5:145967423-145967445 CATGGGATCTGGCATATGGCAGG - Intronic
1001083172 5:168681706-168681728 CTGGTGATTTGGTAGAAGGCTGG - Intronic
1004817280 6:19325677-19325699 CATGGGACTTGGCATGAGGCAGG - Intergenic
1012773751 6:103478143-103478165 CTAGGGATTTGCCATAATGTAGG + Intergenic
1018750456 6:166799910-166799932 CTGGGGACTTGGCAGAAGGGTGG - Intronic
1022733001 7:33048774-33048796 CTCAAAATTTGGCATAATGCTGG + Intronic
1025839785 7:65135312-65135334 CACAGGCTTTGGCATGAGGCAGG + Intergenic
1025890165 7:65641953-65641975 CACAGGCTTTGGCATGAGGCAGG + Intergenic
1031985657 7:128163219-128163241 CTTGGGATTTGGCTTCTGGCTGG - Intergenic
1033033278 7:137846986-137847008 CTCGGGATTTAGGAAGAGGCCGG - Intronic
1036696774 8:10979998-10980020 CTCAGGGTTTGGCATGAGCCAGG - Intronic
1038256891 8:25958535-25958557 ATGGGGATTTGGCACAAAGCTGG - Intronic
1044340449 8:91040879-91040901 CCCGGGATGTGTCACAAGGCAGG + Exonic
1045876967 8:106992890-106992912 CTGGGCTATTGGCATAAGGCTGG + Intergenic
1053286502 9:36852668-36852690 CTCGGGGTTAGGCAGAATGCCGG - Intronic
1057568916 9:96188975-96188997 CTCTGGACTTGGTATAATGCTGG + Intergenic
1059607220 9:115846736-115846758 CTAGGGCTTTGGCACAAAGCAGG + Intergenic
1186995959 X:15122687-15122709 CTCTGGATTTGGCACAGGGCAGG + Intergenic
1190755697 X:53399939-53399961 CTGTGGACATGGCATAAGGCAGG + Intronic
1192205254 X:69091546-69091568 CCAGGGATTTGGAATGAGGCAGG - Intergenic