ID: 1166185524

View in Genome Browser
Species Human (GRCh38)
Location 19:41136518-41136540
Sequence TGTACTCGGGATTTGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166185524_1166185531 12 Left 1166185524 19:41136518-41136540 CCTTATGCCAAATCCCGAGTACA 0: 2
1: 0
2: 0
3: 4
4: 60
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data
1166185524_1166185528 -5 Left 1166185524 19:41136518-41136540 CCTTATGCCAAATCCCGAGTACA 0: 2
1: 0
2: 0
3: 4
4: 60
Right 1166185528 19:41136536-41136558 GTACACAGACGTACCTACAATGG No data
1166185524_1166185529 -4 Left 1166185524 19:41136518-41136540 CCTTATGCCAAATCCCGAGTACA 0: 2
1: 0
2: 0
3: 4
4: 60
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166185524 Original CRISPR TGTACTCGGGATTTGGCATA AGG (reversed) Intergenic
909204967 1:72744199-72744221 TTTACTCAGGATGTGGCATTTGG - Intergenic
911340300 1:96628092-96628114 TGTAATTAGGATTTGGAATAGGG - Intergenic
919344543 1:196358850-196358872 TGTACTCGAAATTTGAAATATGG - Intronic
1071371446 10:84955657-84955679 TTTACTCTGGATTTGGCCTGAGG + Intergenic
1071766861 10:88676550-88676572 TGTGCTGGGGATCTGGGATATGG - Intronic
1079347426 11:19665149-19665171 TGTTCTCTTGATTTGGCATCAGG - Intronic
1079459402 11:20667119-20667141 TGGACTTGGGATCTGGCATCAGG + Intergenic
1079722756 11:23839459-23839481 TGAACTAGGGATTTGGGAAATGG + Intergenic
1083608199 11:63991636-63991658 TGTGCCAGGGATTTGGCACAGGG - Intronic
1102665946 12:114572947-114572969 TGTCATAGGGGTTTGGCATAAGG + Intergenic
1105260688 13:18777144-18777166 TGTGCTCGGGATGTGGGATCTGG - Intergenic
1108103549 13:46983916-46983938 TGGACTCGGGATCTGGAAGATGG - Intergenic
1111479999 13:88811541-88811563 TGTACACTGGATGTGGGATATGG + Intergenic
1111994144 13:95146472-95146494 TGTGCTGGGAATTTTGCATAAGG - Intronic
1114611084 14:24041107-24041129 TGTGCTCCGGATTTGGCCCACGG - Intergenic
1118929976 14:70232739-70232761 TGTACACGGGATTTGCCACAGGG - Intergenic
1120615060 14:86694021-86694043 AGTAGGCTGGATTTGGCATATGG + Intergenic
1124170182 15:27366213-27366235 TGGACTCGGGAGATGGCAGAAGG + Intronic
1133462403 16:5998636-5998658 TGCACTCAGGATTTGGAAAAGGG - Intergenic
1139116683 16:63962800-63962822 TGAACACAGTATTTGGCATATGG + Intergenic
1141924000 16:87155110-87155132 AGCATTCAGGATTTGGCATACGG + Intronic
1145741800 17:27281040-27281062 AGTGCTGGGGATTTGGCATTAGG + Intergenic
1149815895 17:59723485-59723507 TGTCCTTTGGATTTGGCAAATGG + Intronic
1152258750 17:79255250-79255272 TGTACTGGGGGTGTGGCATGAGG + Intronic
1154262011 18:12843446-12843468 TGTACTCGGGATTGGGGTGAGGG - Intronic
1157480313 18:48049876-48049898 TGCCCTGGGGATTTGGCAGATGG - Intronic
1158284022 18:55858768-55858790 TGGAGTCGGGTTTTAGCATAAGG + Intergenic
1160396320 18:78574817-78574839 TGTGCCCTGGATGTGGCATATGG + Intergenic
1161373470 19:3926841-3926863 TGTGCCCGGGATTTGACATTTGG - Exonic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
946700639 2:222409735-222409757 TGTCATGGGGATTTGGCGTACGG + Intergenic
1174582525 20:51582178-51582200 TGTGCTCTGGATTAGGAATAAGG - Intergenic
1176970968 21:15265273-15265295 TCTCCTGGGGATTTGGCATTGGG - Intergenic
1180100457 21:45581559-45581581 TGTCCTCGGGAACTGGCTTATGG + Intergenic
951241140 3:20287624-20287646 TGTACCCAGGATATGGGATATGG - Intergenic
954135978 3:48582425-48582447 GGTACTAGGGATGTGGCAGATGG - Intronic
965388257 3:168072030-168072052 TGGACTCTGGATTTCCCATAGGG + Intronic
976789819 4:88865790-88865812 GGTACGCGGGATTTGGCCTGTGG + Intronic
976800552 4:88986548-88986570 TGTCTTCGCCATTTGGCATATGG - Intronic
981448102 4:144864213-144864235 TGTCATAGGGGTTTGGCATACGG - Intergenic
986165247 5:5267305-5267327 TGTCCTCGGGATAAGGCAAAGGG - Intronic
990159373 5:52920494-52920516 TGTATTCTTGATTTGGAATAAGG - Intronic
990524319 5:56609924-56609946 TGTACTCCGAATGTGGCAAATGG - Intergenic
993973284 5:94445742-94445764 TGAACTAGGTATTTAGCATATGG - Intronic
997831984 5:137158120-137158142 TTTACTGGGGATTGGGCATTTGG - Intronic
1001071219 5:168586953-168586975 TGTTCTAGGGATTAGGGATATGG + Intergenic
1007706506 6:43794518-43794540 TGTCGTCGTGATTTGGCACAAGG + Intergenic
1014889449 6:126824911-126824933 TGTTCTAGAGATATGGCATATGG + Intergenic
1016990270 6:149923561-149923583 TCCACTCGGGATTTGGGATGAGG - Intergenic
1017185690 6:151598232-151598254 TTTAGTGGGGATTTGGAATAGGG + Intronic
1020497296 7:8871907-8871929 TGTAATCACGATTTGGCAAAGGG + Intergenic
1026407143 7:70078061-70078083 TGTACTCAGGGTCAGGCATATGG + Intronic
1027909756 7:84234975-84234997 TTTACTCTGCATGTGGCATAAGG + Intronic
1030008512 7:105142007-105142029 AGTACTGGGGATTTGCCAAAAGG - Exonic
1031957379 7:127956148-127956170 TGTGCTAAGGATTGGGCATATGG - Intronic
1035369474 7:158370108-158370130 CTGACTGGGGATTTGGCATAAGG + Intronic
1038909040 8:31941066-31941088 TGTCCTCTGGCTTTGGCATTAGG - Intronic
1043483475 8:80676090-80676112 TGTTCCTTGGATTTGGCATATGG + Intronic
1044559915 8:93602868-93602890 TGTGCTCTGGATTTGGCATTAGG + Intergenic
1047454214 8:124994384-124994406 TATACTCAGTATTTGGCATATGG - Intergenic
1059232278 9:112732009-112732031 TGTGCTTGGGATCTGGCATTTGG + Intergenic
1186995958 X:15122683-15122705 GATACTCTGGATTTGGCACAGGG + Intergenic
1187774091 X:22735476-22735498 TCTACTCAAGATTTGGCATATGG + Intergenic
1187797606 X:23021419-23021441 TGAACTCTGGATCTGGGATAGGG + Intergenic
1192723128 X:73721360-73721382 TTTACTCGTGATTTGGCTTTTGG + Intergenic