ID: 1166185525

View in Genome Browser
Species Human (GRCh38)
Location 19:41136525-41136547
Sequence ACGTCTGTGTACTCGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166185525_1166185531 5 Left 1166185525 19:41136525-41136547 CCAAATCCCGAGTACACAGACGT No data
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166185525 Original CRISPR ACGTCTGTGTACTCGGGATT TGG (reversed) Intergenic
No off target data available for this crispr