ID: 1166185527

View in Genome Browser
Species Human (GRCh38)
Location 19:41136532-41136554
Sequence TGTAGGTACGTCTGTGTACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166185527_1166185531 -2 Left 1166185527 19:41136532-41136554 CCGAGTACACAGACGTACCTACA No data
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166185527 Original CRISPR TGTAGGTACGTCTGTGTACT CGG (reversed) Intergenic
No off target data available for this crispr