ID: 1166185529

View in Genome Browser
Species Human (GRCh38)
Location 19:41136537-41136559
Sequence TACACAGACGTACCTACAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166185521_1166185529 11 Left 1166185521 19:41136503-41136525 CCCTTGTGCGTCCAGCCTTATGC No data
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data
1166185523_1166185529 0 Left 1166185523 19:41136514-41136536 CCAGCCTTATGCCAAATCCCGAG 0: 2
1: 0
2: 0
3: 8
4: 68
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data
1166185522_1166185529 10 Left 1166185522 19:41136504-41136526 CCTTGTGCGTCCAGCCTTATGCC No data
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data
1166185519_1166185529 26 Left 1166185519 19:41136488-41136510 CCGGCCACAATCTCTCCCTTGTG No data
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data
1166185520_1166185529 22 Left 1166185520 19:41136492-41136514 CCACAATCTCTCCCTTGTGCGTC No data
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data
1166185524_1166185529 -4 Left 1166185524 19:41136518-41136540 CCTTATGCCAAATCCCGAGTACA 0: 2
1: 0
2: 0
3: 4
4: 60
Right 1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166185529 Original CRISPR TACACAGACGTACCTACAAT GGG Intergenic
No off target data available for this crispr