ID: 1166185531

View in Genome Browser
Species Human (GRCh38)
Location 19:41136553-41136575
Sequence CAATGGGACAGTTAGATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166185527_1166185531 -2 Left 1166185527 19:41136532-41136554 CCGAGTACACAGACGTACCTACA No data
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data
1166185526_1166185531 -1 Left 1166185526 19:41136531-41136553 CCCGAGTACACAGACGTACCTAC No data
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data
1166185524_1166185531 12 Left 1166185524 19:41136518-41136540 CCTTATGCCAAATCCCGAGTACA 0: 2
1: 0
2: 0
3: 4
4: 60
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data
1166185522_1166185531 26 Left 1166185522 19:41136504-41136526 CCTTGTGCGTCCAGCCTTATGCC No data
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data
1166185521_1166185531 27 Left 1166185521 19:41136503-41136525 CCCTTGTGCGTCCAGCCTTATGC No data
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data
1166185523_1166185531 16 Left 1166185523 19:41136514-41136536 CCAGCCTTATGCCAAATCCCGAG 0: 2
1: 0
2: 0
3: 8
4: 68
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data
1166185525_1166185531 5 Left 1166185525 19:41136525-41136547 CCAAATCCCGAGTACACAGACGT No data
Right 1166185531 19:41136553-41136575 CAATGGGACAGTTAGATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166185531 Original CRISPR CAATGGGACAGTTAGATTCT TGG Intergenic
No off target data available for this crispr