ID: 1166185653

View in Genome Browser
Species Human (GRCh38)
Location 19:41137212-41137234
Sequence GCACGTGGTCGTCCGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166185653_1166185661 7 Left 1166185653 19:41137212-41137234 CCCAAGCCCGGACGACCACGTGC No data
Right 1166185661 19:41137242-41137264 CTACACCAACGCAGTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166185653 Original CRISPR GCACGTGGTCGTCCGGGCTT GGG (reversed) Intergenic
No off target data available for this crispr