ID: 1166189351

View in Genome Browser
Species Human (GRCh38)
Location 19:41165475-41165497
Sequence CTTTGTAAGGCGAAGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166189344_1166189351 -8 Left 1166189344 19:41165460-41165482 CCTGTAATCCCAGCACTTTGTAA 0: 67
1: 12455
2: 313856
3: 264775
4: 144378
Right 1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166189351 Original CRISPR CTTTGTAAGGCGAAGGTGGG CGG Intergenic
No off target data available for this crispr