ID: 1166189553

View in Genome Browser
Species Human (GRCh38)
Location 19:41166920-41166942
Sequence CTGCAACCACAGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166189553_1166189563 19 Left 1166189553 19:41166920-41166942 CCCTGCTCCCTCTGTGGTTGCAG No data
Right 1166189563 19:41166962-41166984 CAGGGTTAAGATTCGTTCCAAGG No data
1166189553_1166189564 24 Left 1166189553 19:41166920-41166942 CCCTGCTCCCTCTGTGGTTGCAG No data
Right 1166189564 19:41166967-41166989 TTAAGATTCGTTCCAAGGCCTGG No data
1166189553_1166189561 1 Left 1166189553 19:41166920-41166942 CCCTGCTCCCTCTGTGGTTGCAG No data
Right 1166189561 19:41166944-41166966 TAGGGTTCATTCTTGGTCCAGGG No data
1166189553_1166189560 0 Left 1166189553 19:41166920-41166942 CCCTGCTCCCTCTGTGGTTGCAG No data
Right 1166189560 19:41166943-41166965 TTAGGGTTCATTCTTGGTCCAGG No data
1166189553_1166189559 -6 Left 1166189553 19:41166920-41166942 CCCTGCTCCCTCTGTGGTTGCAG No data
Right 1166189559 19:41166937-41166959 TTGCAGTTAGGGTTCATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166189553 Original CRISPR CTGCAACCACAGAGGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr