ID: 1166194312

View in Genome Browser
Species Human (GRCh38)
Location 19:41196084-41196106
Sequence ACGAGGGTAAAGAGGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166194304_1166194312 29 Left 1166194304 19:41196032-41196054 CCTAAAATGAGAGGTACAGATTT 0: 1
1: 0
2: 0
3: 20
4: 248
Right 1166194312 19:41196084-41196106 ACGAGGGTAAAGAGGGAATCAGG 0: 1
1: 0
2: 0
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166194312 Original CRISPR ACGAGGGTAAAGAGGGAATC AGG Intronic
900742714 1:4340394-4340416 GCGAGGGCAGAGATGGAATCAGG + Intergenic
905671409 1:39792749-39792771 ATGAAGGTGAAGAGGGCATCAGG - Intergenic
906258558 1:44368795-44368817 ACAAGGGGAAAGGGGGATTCTGG + Intergenic
907255259 1:53174048-53174070 GAGAGGGTGAAGAGGGAATGTGG - Intergenic
907283856 1:53367978-53368000 ACAAGGGGAAAGAGGGCATGGGG - Intergenic
914946757 1:152073548-152073570 AGGAGGGTAGGGAGGGAGTCAGG - Intergenic
915591308 1:156872110-156872132 GCGAGCGTAAAGAGGAACTCAGG - Intronic
919104418 1:193131186-193131208 CAGAAGGGAAAGAGGGAATCAGG - Intronic
920524647 1:206657885-206657907 TTGAGGGAAATGAGGGAATCGGG - Intronic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
1067441593 10:46311813-46311835 ACGAGGGTGAGGTGGGCATCTGG - Intronic
1068973866 10:62987116-62987138 AGGAGGGTCAAGTGGGATTCAGG - Intergenic
1069658187 10:70105821-70105843 AAGAGGGAAAAAGGGGAATCGGG + Intronic
1073071721 10:100798618-100798640 ATGAGGGGAAAGTGGGATTCCGG - Intronic
1074439404 10:113461660-113461682 GAGAGGGAAAACAGGGAATCCGG - Intergenic
1078396828 11:10988884-10988906 AGGCAGGTAAAGAGGGAATGAGG - Intergenic
1078730819 11:13972320-13972342 TCTAGGTTAAAGAGGGAAGCAGG - Intronic
1085557494 11:77438173-77438195 CAGAAGGTAAAGAGGGAAACAGG + Intronic
1085723003 11:78929629-78929651 GAGATGGTAAAGAGGGAACCTGG + Intronic
1089871274 11:121674443-121674465 ATGAAGGTAAAGAGGCACTCAGG - Intergenic
1098529948 12:71530435-71530457 AGGATGGTAAAGAGGGCATATGG + Intronic
1102777368 12:115532399-115532421 ATGAGGGTAAAGACGGGAACTGG - Intergenic
1106563582 13:30867017-30867039 ACCAGAGTAAATAGCGAATCGGG + Intergenic
1107477298 13:40750961-40750983 AAGTGGGTAAAGAGGTAAGCTGG - Intronic
1110632512 13:77725726-77725748 CCTAGGGTAAAGAGGAAATAAGG - Intronic
1112965824 13:105192381-105192403 ACAAGGGTACAGAGAGAAACCGG + Intergenic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1113754965 13:112804332-112804354 ACGAGGGCAGAGAGGGGATGGGG - Intronic
1116147501 14:41093897-41093919 AGGAGAGAAAAGAGAGAATCTGG + Intergenic
1117886945 14:60374091-60374113 AGGAAGTTAAAGAGGAAATCGGG + Intergenic
1118807008 14:69246554-69246576 AGAAGGGTAATGAGGGAAGCAGG + Intergenic
1121612250 14:95289650-95289672 ACCAGGGAAAAGAAGCAATCAGG + Intronic
1125378198 15:39056688-39056710 AGGACAGAAAAGAGGGAATCAGG + Intergenic
1127938178 15:63664016-63664038 ACTAATGTAATGAGGGAATCTGG + Intronic
1129279178 15:74470248-74470270 ACTGGGGTTAAGAGGGAATGAGG + Intergenic
1129534358 15:76299869-76299891 ACCAGGGTAAAGGGAGAAGCTGG - Intronic
1129776113 15:78237569-78237591 GAGAGAGTAGAGAGGGAATCTGG - Intronic
1131712968 15:95075662-95075684 ACTAGTGAAAAGAGGGAAGCGGG - Intergenic
1135936687 16:26786395-26786417 AGGGGGGTCAAGAGGGAATGTGG + Intergenic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1146168751 17:30615647-30615669 ACTATGGTAAAGAAGGAATTAGG + Intergenic
1146221727 17:31029140-31029162 ACTATGGTAAAGAAGGAATTAGG + Intergenic
1146655203 17:34630899-34630921 GCCAGGGGAAGGAGGGAATCTGG - Intronic
1156229282 18:35138209-35138231 AGGGGAGTAAAGAGGGGATCAGG + Intronic
1156358355 18:36362046-36362068 ATGAGGGTAAAGATGACATCAGG + Intronic
1157597733 18:48874175-48874197 ACTAGGGGATGGAGGGAATCTGG - Intergenic
1158280747 18:55822973-55822995 AAGAGGTTAAAGAGGGCATAGGG + Intergenic
1159907899 18:74114619-74114641 ATGAGAGGAAAGAGGGAATGTGG - Intronic
1163389809 19:17023495-17023517 AAGAGGGTAAAGGGGGAAACTGG + Intronic
1166194312 19:41196084-41196106 ACGAGGGTAAAGAGGGAATCAGG + Intronic
1168162537 19:54521139-54521161 ACGTGGGTGAGGAGGGACTCGGG + Intergenic
926597316 2:14805362-14805384 ATGAGGGTAAGGAGGAAAACCGG + Intergenic
926722486 2:15971494-15971516 ACGAGGGTCAGGAGGGAAGAAGG + Intergenic
928230239 2:29492462-29492484 AGGAGTGGGAAGAGGGAATCAGG + Intronic
928983842 2:37161373-37161395 ACGAGGTTAAAGTGGCAACCAGG - Intergenic
929687266 2:44045542-44045564 AGGAGGGTAAAGATGAAAGCAGG - Intergenic
931046008 2:58353842-58353864 ACAAGGGTGAAGAGAGCATCAGG + Intergenic
933274835 2:80272534-80272556 CCCAGGGAAAAGAGGGAAACAGG + Intronic
933595894 2:84282891-84282913 ACCAGAGTAGAGTGGGAATCTGG + Intergenic
935237954 2:101153506-101153528 AGGAGGGTGAAGAGGGGATCTGG + Intronic
936839633 2:116754180-116754202 AAAAGGGAAAAGAGGGAAACAGG - Intergenic
941145624 2:161840905-161840927 ACGAGGTGAAAGAGAGGATCAGG + Intronic
942617819 2:177812798-177812820 AAGCGGGTAAAGAGGGAAAAAGG + Intronic
943428905 2:187773085-187773107 GCGAGGGCAAAGAGAGCATCAGG + Intergenic
946721669 2:222615464-222615486 TTGAGGGTAGAGAGGGAGTCAGG - Intronic
1170257986 20:14367688-14367710 CCAAGGGTAAAGAAGGAATCTGG - Intronic
1172321587 20:33999189-33999211 TGGAGGGTAAGGAAGGAATCGGG + Intronic
1173072566 20:39783511-39783533 ACCAGGATAAAGAGCCAATCTGG - Intergenic
1178103151 21:29291648-29291670 AGGAGGCTGGAGAGGGAATCTGG + Intronic
1178404742 21:32315018-32315040 ACGTGGGTTAAGAGGGTGTCCGG + Exonic
1179008578 21:37535400-37535422 ATGAGGGCAGAGAGGGGATCAGG + Intergenic
1179681299 21:43023067-43023089 ACGAGGGTGAGGAGGGACTGAGG - Intronic
1182962165 22:34485444-34485466 AGAAGGGAAAAGAGGGAAGCAGG + Intergenic
950314161 3:11985994-11986016 AAGAGGATAGAGAGAGAATCCGG - Intergenic
953346506 3:42180330-42180352 ATCAGGGTAAATAGGGTATCAGG + Intronic
957622651 3:82614412-82614434 ACGAGAGTAAAGAGGTGACCAGG - Intergenic
959579099 3:107965907-107965929 AAGAGAGTGAAGAGGGAGTCAGG + Intergenic
960276017 3:115730130-115730152 ACAAGGGGAGAGAGAGAATCAGG - Intergenic
965895143 3:173566611-173566633 TAGAGGGTAGAGAGGGAGTCTGG - Intronic
968298421 3:197594862-197594884 CCGAGGGGAAAGAAGGGATCCGG + Intergenic
973074611 4:45907243-45907265 AGCAGGGGAAAGAGGGAAACAGG - Intergenic
977303804 4:95298540-95298562 AGGAGGGGCAAGAGGGAATCAGG - Intronic
977586872 4:98783828-98783850 AGGAGGGTAGAAAGGGAATCTGG + Intergenic
979142026 4:117188534-117188556 ACAAGGCTAAAGATAGAATCAGG - Intergenic
981588861 4:146334424-146334446 AGGAGGGAAAAGAGGCAATTTGG + Intronic
981619851 4:146682392-146682414 AGGAGGATAAATAGGGAATGGGG + Intergenic
981628357 4:146787844-146787866 AGGAGGGGAAGGAGGGAAACTGG - Intronic
984850666 4:184149867-184149889 AGGAGGGAAAATAGGGAATATGG - Intronic
985181641 4:187271527-187271549 ACGAGGGTAGGGAGAAAATCGGG - Intergenic
995250691 5:109989947-109989969 AAGAGGGTAAAGAGGGTATGTGG - Intergenic
995973604 5:118003914-118003936 ACGAGGTTAAAGATGGAAGCAGG + Intergenic
997098741 5:130944046-130944068 ACCAGAGGAAAGAGGGCATCTGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1000222121 5:159224217-159224239 ACTAGGGTAAATGGGGAAACAGG - Intergenic
1000340674 5:160274946-160274968 AGGAAGGAAGAGAGGGAATCTGG + Intronic
1004862586 6:19820102-19820124 TCGAGGGTAAAGGGAGAACCTGG + Intergenic
1010656549 6:78518316-78518338 TCCAGGGTATAGAGGGAATCTGG + Intergenic
1011429792 6:87273211-87273233 AAGAGGGTATAGTGGGAATAAGG + Intergenic
1013566176 6:111366042-111366064 AGGTGGGTAATGAGGGAATGAGG + Intronic
1013846117 6:114453654-114453676 ATCATGCTAAAGAGGGAATCTGG - Intergenic
1014155462 6:118104164-118104186 AGGAAGGAAAAGAGGGAATGTGG - Intronic
1015551267 6:134414577-134414599 AGAAGGGTAAAGTGTGAATCTGG + Intergenic
1016804938 6:148203190-148203212 AAGATGGAAAAGATGGAATCAGG - Intergenic
1017668459 6:156745357-156745379 ATGTGAGTAAAGAGGGAATTTGG + Intergenic
1020978200 7:15033949-15033971 AAGAAGGTAAAGAGGGACTAGGG + Intergenic
1021611185 7:22459750-22459772 ACGGGGGTAAGGATGGAGTCTGG - Intronic
1030732156 7:113003135-113003157 ATAAGGGGAAAAAGGGAATCAGG - Intergenic
1035076391 7:156180370-156180392 CCCAGGGTAGAGAGGGAATCAGG + Intergenic
1035928624 8:3757176-3757198 ATGAGGGTAAAGAGTGGATGTGG - Intronic
1036088476 8:5638781-5638803 ATGAGGGTAAAGAGGAAATAAGG + Intergenic
1036541461 8:9716663-9716685 AAGAGGGGAAAGAGGGAAGCAGG - Intronic
1037977524 8:23224341-23224363 ACGGGGGTGGGGAGGGAATCAGG + Intronic
1045695616 8:104805859-104805881 AGAAGGGTAAAGAGAGGATCTGG + Intronic
1046784606 8:118252639-118252661 AGGAAGGAAAAGAGGGAATGAGG - Intronic
1047372443 8:124267103-124267125 GAGAGGGTGCAGAGGGAATCTGG - Intergenic
1048000839 8:130378349-130378371 GCAATGGTAAAGAGGAAATCAGG + Intronic
1051384558 9:16493942-16493964 ACGAGGGTAGAGAGGCAGGCAGG + Intronic
1057214995 9:93223065-93223087 ATGAGGTTAAAGAGGGAACTTGG + Intronic
1057343373 9:94224356-94224378 ACGAGGGGAAAGAGGGAAGGAGG - Intergenic
1059344297 9:113617501-113617523 AGGAAGGTAGAGAGGGTATCAGG - Intergenic
1061193129 9:129093832-129093854 AAGCGGGTAAAGAGGGAGGCTGG - Intergenic
1061437537 9:130574887-130574909 ACGAGGCCAAAGGTGGAATCGGG + Intergenic
1186453424 X:9691962-9691984 AAGATGGCAAAGAGGGAAACAGG + Intronic
1191007510 X:55726008-55726030 ATGAGACTAAAGAGGGAAGCAGG + Intronic
1195053052 X:101115806-101115828 AGCAGGGGAAAGAGGGAATAGGG - Intronic
1198320972 X:135518861-135518883 AAAAGGGAAGAGAGGGAATCTGG - Intergenic
1199939936 X:152615220-152615242 ATGAGGGTAAAGAGGCAGGCAGG + Intergenic