ID: 1166196769

View in Genome Browser
Species Human (GRCh38)
Location 19:41211483-41211505
Sequence CACTCTCCTGCCTCAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3675
Summary {0: 3, 1: 13, 2: 49, 3: 230, 4: 3380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166196769_1166196772 -10 Left 1166196769 19:41211483-41211505 CCAGCTACTGAGGCAGGAGAGTG 0: 3
1: 13
2: 49
3: 230
4: 3380
Right 1166196772 19:41211496-41211518 CAGGAGAGTGGTGTGAACCCGGG 0: 88
1: 8772
2: 45748
3: 45334
4: 110094
1166196769_1166196773 -7 Left 1166196769 19:41211483-41211505 CCAGCTACTGAGGCAGGAGAGTG 0: 3
1: 13
2: 49
3: 230
4: 3380
Right 1166196773 19:41211499-41211521 GAGAGTGGTGTGAACCCGGGAGG 0: 53
1: 5319
2: 34858
3: 44692
4: 73715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166196769 Original CRISPR CACTCTCCTGCCTCAGTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr