ID: 1166197917

View in Genome Browser
Species Human (GRCh38)
Location 19:41219055-41219077
Sequence CTTTCTTAAAGGGGCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166197917_1166197926 23 Left 1166197917 19:41219055-41219077 CCTCCCTGGCCCCTTTAAGAAAG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1166197926 19:41219101-41219123 TTAACCCCTGATTGTCCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 76
1166197917_1166197925 20 Left 1166197917 19:41219055-41219077 CCTCCCTGGCCCCTTTAAGAAAG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1166197925 19:41219098-41219120 GAGTTAACCCCTGATTGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 78
1166197917_1166197930 30 Left 1166197917 19:41219055-41219077 CCTCCCTGGCCCCTTTAAGAAAG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1166197930 19:41219108-41219130 CTGATTGTCCAGGTGGCCCCTGG 0: 1
1: 0
2: 2
3: 11
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166197917 Original CRISPR CTTTCTTAAAGGGGCCAGGG AGG (reversed) Intergenic
900599098 1:3495556-3495578 CCTTCTGCAAGGGGCCAGGCAGG + Intronic
900910470 1:5593758-5593780 CATCCTAAAAGGGGCCAGCGTGG + Intergenic
901474720 1:9481563-9481585 TTTTGTTATAGGGTCCAGGGTGG - Intergenic
905307779 1:37031525-37031547 CTTTCTTGCAGGTGCCAGAGGGG - Intronic
905775991 1:40667440-40667462 CTCTGTGAAAGGGGCCAGGGAGG - Intergenic
907674272 1:56504291-56504313 CTTTCTTTAAAGGGCGGGGGCGG - Intronic
909538665 1:76767022-76767044 CCTTCTGAAAGGGTCCAGAGGGG - Intergenic
909959340 1:81819855-81819877 CTTTCTGAAAAGGGGCAGGCTGG - Intronic
911102941 1:94108158-94108180 CTATCATTAAGGAGCCAGGGAGG - Intronic
912498827 1:110108443-110108465 CTTTCCTAAGGGGGACAGTGGGG - Intergenic
915141731 1:153772250-153772272 CTGTCTTAAGGGGGCCCTGGCGG + Intronic
915248871 1:154574484-154574506 CGTTTTTAAAGGGACCAGGCCGG + Intronic
915571954 1:156749694-156749716 CTTCCTCACAGGGGCCAGTGTGG + Intronic
916481129 1:165215470-165215492 CTTTCTTGAAGTGGCCAGAAGGG - Intronic
920285403 1:204875280-204875302 CTCTCATAAAGAGGCCTGGGAGG + Intronic
920338367 1:205259800-205259822 TGTTGTGAAAGGGGCCAGGGAGG + Intronic
920716536 1:208345373-208345395 CTTGCTTTGAGGGGACAGGGAGG + Intergenic
923707517 1:236356500-236356522 CTTTCTGCAAGGGGCCTGTGAGG + Intronic
1065045301 10:21742728-21742750 CTTTCAGAAAGGGGCCACTGTGG + Exonic
1065787693 10:29231370-29231392 GTTTCTTAAAGTGGGCATGGAGG + Intergenic
1066277665 10:33884758-33884780 GTTTCTGAGACGGGCCAGGGAGG - Intergenic
1066341607 10:34539817-34539839 CTTCCTGAAATAGGCCAGGGCGG + Intronic
1066511175 10:36098367-36098389 CTCTCTTAAGTGGGACAGGGTGG - Intergenic
1068775394 10:60863111-60863133 CTTTCTAAAAAAGGCCAGGATGG - Intergenic
1069606006 10:69739157-69739179 CCTTCTCAACGAGGCCAGGGAGG + Intergenic
1072496921 10:95970836-95970858 CTTTGTCAAAGGGACCAGTGTGG + Intronic
1077452066 11:2654302-2654324 ATTTCTTGAGGGGGCCAGGGAGG + Intronic
1081341524 11:41933700-41933722 CTTTTTTTAAGGGGTAAGGGAGG - Intergenic
1084938244 11:72598804-72598826 ATTACTTAAAGTGGCCAGGAAGG - Intronic
1086522794 11:87689729-87689751 TCTTCTTAAGGGAGCCAGGGAGG + Intergenic
1088259083 11:107928134-107928156 TTTTCTTACAGGCGTCAGGGCGG - Intronic
1088715549 11:112546087-112546109 CTTTCTTAAAGACTCCTGGGAGG + Intergenic
1089328897 11:117676514-117676536 TTTTCCCAAAGGGTCCAGGGGGG + Intronic
1090904696 11:131065014-131065036 CTTTATTGAAGGGCCGAGGGAGG + Intergenic
1092231942 12:6780844-6780866 CTTTCATAAAGGGGACAGGGAGG + Intergenic
1092807937 12:12244174-12244196 TTTTCTCATAGGGGTCAGGGTGG + Intronic
1096309297 12:50505656-50505678 CTTTTTGAAAGGGGGAAGGGGGG - Intronic
1103926381 12:124425728-124425750 GTTTGTGAATGGGGCCAGGGAGG - Intronic
1104263919 12:127212682-127212704 CTTTCTTGGAGGCTCCAGGGCGG + Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1107913710 13:45128261-45128283 ATTTTTTAAAAAGGCCAGGGGGG - Intronic
1113269639 13:108659506-108659528 CTTTTTTAGGGGGGCAAGGGAGG - Intronic
1119956985 14:78809258-78809280 CTTTTTTAAATGGGAAAGGGAGG - Intronic
1121999601 14:98635931-98635953 CCTTTCTACAGGGGCCAGGGAGG + Intergenic
1125635262 15:41182694-41182716 TTTTCTTAATTGGGTCAGGGTGG - Intergenic
1126459605 15:48900914-48900936 TTTTCTGAAAAGGGCCAGGTAGG + Intronic
1127939086 15:63675383-63675405 CTTTCTGTAAGGGGCCAGACAGG + Intronic
1128202827 15:65824185-65824207 TTTTCCTAAAGAGGCCAGTGAGG + Intronic
1129870167 15:78934814-78934836 CTTCCTTTGAGGGGCCAGGGAGG - Intronic
1131434473 15:92412126-92412148 CTCTGATAAAGGGGCCAGAGAGG + Intronic
1131609039 15:93941551-93941573 CATTCTTAAAGGTGGCAGAGGGG - Intergenic
1132645429 16:997285-997307 CTTCCCTGAAGGGGCCAGTGTGG - Intergenic
1137744921 16:50813390-50813412 CTTGCCTACAGGGGCCAGGCAGG + Intergenic
1137875466 16:51992627-51992649 CTTGCTTAAAGGGGTTATGGGGG + Intergenic
1139176024 16:64688719-64688741 TTTTCTAAAAAGGGCCAGAGGGG - Intergenic
1139654450 16:68378782-68378804 CTTTCCTAAAGGGCCCAGTAAGG - Intronic
1141713794 16:85715531-85715553 CTTTCTGCAAGGGGCCAGGCAGG + Intronic
1142121721 16:88389841-88389863 CTGTCCTCAGGGGGCCAGGGAGG - Intergenic
1142411832 16:89920970-89920992 CTTTCTGGAAGGGGCTAAGGTGG - Exonic
1143252003 17:5530364-5530386 CTTCCTTAGAGGGGCCGAGGGGG - Intronic
1145997281 17:29111903-29111925 CTGTGGGAAAGGGGCCAGGGTGG + Intronic
1146581647 17:34043897-34043919 CTTTCATGACTGGGCCAGGGAGG - Intronic
1146928104 17:36758754-36758776 CTTTTTTAAAGGTCCCAGAGGGG + Intergenic
1149775811 17:59356095-59356117 CTTTCTTAAATGGAAGAGGGAGG - Intronic
1151725129 17:75878968-75878990 CTTTGCTAAGGGTGCCAGGGAGG - Intergenic
1151832426 17:76562108-76562130 CTTTGTTAAGGACGCCAGGGAGG + Intergenic
1151834056 17:76571992-76572014 CATTCTTCCAGGGGCCAGTGTGG + Intronic
1153163898 18:2240508-2240530 GTTTCTTTAAGGGATCAGGGCGG - Intergenic
1158542034 18:58365724-58365746 GTTTATTAAAGGGGGCAAGGAGG + Intronic
1158839772 18:61372812-61372834 TTTTCTATAAGGGGCCAGAGAGG - Intronic
1160026995 18:75226744-75226766 ATTTATCAAAGGGGCCAGGCCGG + Intronic
1161237438 19:3204925-3204947 CTTCCTTACTGGGGCTAGGGAGG + Intronic
1163844349 19:19629940-19629962 CCTTATTTAAGGTGCCAGGGTGG + Exonic
1164391368 19:27824274-27824296 CTTATTTAAAGGGGTGAGGGTGG + Intergenic
1166197917 19:41219055-41219077 CTTTCTTAAAGGGGCCAGGGAGG - Intergenic
1166360493 19:42251082-42251104 TTTTCTTAAAAGGACCAGGAGGG + Intronic
925043918 2:756498-756520 CTATGTTAAATGGGCCAAGGTGG - Intergenic
925190116 2:1875800-1875822 CTTTGTTCAAGGGTCCAGTGAGG + Intronic
927814788 2:26205574-26205596 CTTTCTTTGAGAGGCCAAGGCGG + Intronic
935374470 2:102380676-102380698 CTTTCTGAGAGGGCTCAGGGAGG + Intronic
937179577 2:119979772-119979794 CTTTCTTAAGGGTGTCAAGGTGG - Exonic
942997709 2:182284582-182284604 CTTGCTTAAAGGGGGCATGTTGG + Intronic
943537882 2:189175285-189175307 CTTCATAAAAGGGGGCAGGGTGG + Intronic
945989611 2:216384261-216384283 CTTTCTTAAAAGAGCCAGTTGGG + Intergenic
946320732 2:218952931-218952953 TTTTCATTAAAGGGCCAGGGTGG - Intergenic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1169349113 20:4854044-4854066 CTTTCTTTCAGGGACCAGGCAGG + Exonic
1169550305 20:6695456-6695478 CTGTCTTAGAGGGTCCATGGTGG - Intergenic
1170576587 20:17667247-17667269 TTTTCTTAAAGGGGGAAGGCTGG + Intronic
1170703703 20:18726864-18726886 CTTACTTATAGGGGCCAGAAAGG + Intronic
1170815889 20:19713959-19713981 TTTTCTACAAGGGGCCAGAGAGG + Intronic
1173837610 20:46136156-46136178 CTCCCTTAAATGGGCCTGGGAGG + Intergenic
1174377348 20:50134880-50134902 CTTTCTTTAAAGGGTCAGGCAGG + Intronic
1176061262 20:63173936-63173958 CCTTCTCACTGGGGCCAGGGAGG + Intergenic
1176072850 20:63235894-63235916 CTTTCTGGAAGTGGCCAGGGTGG - Exonic
1182880133 22:33726014-33726036 CTTCCTTATGGGGGGCAGGGAGG - Intronic
1183288183 22:36981105-36981127 ATATCTCAAAGGGACCAGGGAGG - Intergenic
949963489 3:9334970-9334992 CCTGCCTACAGGGGCCAGGGAGG + Intronic
950194600 3:11000202-11000224 TTTTCTTAAAGGCCCCTGGGGGG + Intronic
950584306 3:13881455-13881477 CTTTCTTCTTGGGGCCAGGAAGG + Intergenic
951804228 3:26627116-26627138 CTTTGTTGAAGGGGCCAGGTAGG - Intronic
952051978 3:29395002-29395024 ATTGCTGAAAGGGGCCAGAGAGG - Intronic
953876811 3:46671307-46671329 TCTTATTAAAGGAGCCAGGGAGG - Intronic
954869325 3:53755859-53755881 CTTTCACAAAGAAGCCAGGGAGG + Intronic
958748874 3:98171169-98171191 CTTTCTTGAAGGGGCAAGAGAGG + Intronic
960710018 3:120518729-120518751 CTTTCTTGAAGGGTCAAGTGGGG + Intergenic
961353629 3:126320082-126320104 CCTTCCTAGAGGGGCCAAGGAGG + Intergenic
962244235 3:133778254-133778276 CCTGCTTAAAGAGGTCAGGGAGG + Intronic
963962800 3:151328450-151328472 CTTCCTTAAAGGGGCCTCTGGGG - Exonic
965733886 3:171800848-171800870 CTTTATAAAAGAGGCCAGAGAGG - Intronic
968625285 4:1624135-1624157 CTTGCTCAGTGGGGCCAGGGAGG + Intronic
970764557 4:19531916-19531938 CTTTCTTCATGGGGCATGGGAGG + Intergenic
971882924 4:32404767-32404789 CTTTCTTAAAAGGTACAGTGAGG + Intergenic
976239775 4:82942902-82942924 TTTTCTTTACCGGGCCAGGGAGG - Intronic
977045789 4:92067733-92067755 ATTGATTAAAGGGGCCAGTGGGG - Intergenic
977654452 4:99505086-99505108 CTTTGTTGAAGCTGCCAGGGTGG + Intergenic
978164975 4:105596300-105596322 CTTTTTCAAAGGAGCAAGGGAGG + Intronic
978537149 4:109774494-109774516 CTTGGTCAAAGGGGCCAGTGTGG + Intronic
982889870 4:160833451-160833473 CTTTCTTTTAGGGGGCTGGGGGG - Intergenic
985142283 4:186853779-186853801 ATTTTTTAAAGGGGCAATGGAGG + Intergenic
985425733 4:189828563-189828585 CTTTCTTGCAGGGGCCACCGTGG - Intergenic
985977149 5:3429136-3429158 CTTACCTAAAGAGGCCAAGGCGG + Intergenic
987018234 5:13843159-13843181 CTTTGTTAGAGGGGACAGAGAGG - Intronic
987249750 5:16086863-16086885 TTTTCTCAAAGTGTCCAGGGTGG + Intronic
987767783 5:22257154-22257176 CTTTCTGAAAGGCCCCAGTGTGG - Intronic
988712785 5:33794770-33794792 CTATCTGCAAGGGGCCAGCGGGG + Intronic
993713968 5:91256170-91256192 CTTTCTTTAGGGGGGCAGGGTGG + Intergenic
994098669 5:95870930-95870952 GTTTTTTAAATGCGCCAGGGAGG - Intergenic
994667582 5:102724805-102724827 CTTACTAAAAGGGGCAAGAGAGG + Intergenic
998157597 5:139795574-139795596 CTTTCTTAAAGGGCCCGCGCGGG + Intergenic
998861983 5:146453270-146453292 AGTTTTTAAAGGGGGCAGGGGGG - Intronic
1000605455 5:163322712-163322734 CTTTCTTAAAAGGGCAAGAGAGG - Intergenic
1001642086 5:173251679-173251701 CTTTTTAAAAGGGGACAAGGGGG - Intergenic
1004410909 6:15380677-15380699 ATTTCTTAAAGGGGGCTTGGGGG - Intronic
1005336093 6:24798072-24798094 CTTGCTTAAAGGAACCAGGGAGG - Intronic
1006446126 6:34080721-34080743 CTTTCTGAAAGTGGTCTGGGAGG - Intronic
1011528885 6:88298270-88298292 CTTTTTTAAAGGGCCCGGTGGGG + Intergenic
1012320265 6:97835646-97835668 CTTTCTCAAAGTTGCAAGGGAGG + Intergenic
1012417732 6:99027759-99027781 CTTTTTCAATGAGGCCAGGGTGG + Intergenic
1015156205 6:130099118-130099140 CATTCTTAGAGGAGCCAGTGGGG + Intronic
1017682614 6:156879109-156879131 ATTGCTGCAAGGGGCCAGGGAGG + Intronic
1018919043 6:168158223-168158245 CTTTGTTAAAGGAGACAGAGGGG - Intergenic
1024257763 7:47551159-47551181 CTTTCTCAAATGGGCAAGGTGGG + Intronic
1024669939 7:51585156-51585178 CTTACTCAAAGGGGCCTGTGTGG + Intergenic
1030292146 7:107883479-107883501 TTTTCTTAAAGGAGTGAGGGCGG + Intergenic
1032843589 7:135734136-135734158 CTTTCTTGAGGATGCCAGGGTGG + Exonic
1039555169 8:38469901-38469923 TTTTCTTAAATTAGCCAGGGAGG - Intergenic
1039785567 8:40831660-40831682 CTATCTTTAAAGGGCCAGTGAGG - Intronic
1042104855 8:65315559-65315581 CTTTCTTAAAGCCTCCAGAGAGG - Intergenic
1043240054 8:77921525-77921547 CTTTGGGAAAGGGGCAAGGGAGG + Intergenic
1046101428 8:109618696-109618718 CATTTTTAAAGGAGGCAGGGTGG - Intronic
1046573664 8:115998196-115998218 CTTTCAAAAAGGGGCAAGGGAGG + Intergenic
1046742077 8:117840280-117840302 CTTTCTTGATGGGACCTGGGGGG - Intronic
1047026479 8:120829933-120829955 CTGTCCTAAATGGGTCAGGGAGG - Intergenic
1049150833 8:141034500-141034522 CCTTCTTGAAGAGGCCAGGGTGG + Intergenic
1050820364 9:9871736-9871758 CTTCCGGAAAGGGGCCTGGGAGG + Intronic
1052527084 9:29631736-29631758 CCCTCTTAAATGGGACAGGGAGG + Intergenic
1052818361 9:33119418-33119440 CCTTCTTATAGGGCCAAGGGCGG + Intronic
1053141169 9:35683531-35683553 CTTGCTTAGAGGGGAGAGGGAGG + Intronic
1055930814 9:81558148-81558170 CTTTCTTCAAAGGGGCAGAGAGG + Intergenic
1056079349 9:83074727-83074749 CTTTCTGTAAAGGGCCAGAGGGG - Intergenic
1056329208 9:85508053-85508075 CTGCCTTCAAAGGGCCAGGGAGG + Intergenic
1056735412 9:89205533-89205555 CTTCCTTAAAGGGCACAGGTGGG + Intergenic
1057706997 9:97401923-97401945 GTTTCATAAATGGGGCAGGGAGG + Intergenic
1058562194 9:106241950-106241972 CTCTCTTAGAAGGGCCAGAGAGG + Intergenic
1059309592 9:113378913-113378935 CCCTCTCAAAGGGGCCTGGGTGG - Intergenic
1059361134 9:113742826-113742848 CTCTATAAAAGGGGCAAGGGTGG - Intergenic
1061720147 9:132546379-132546401 CCTTCATAATGGGGCCGGGGTGG - Intronic
1062358737 9:136177580-136177602 CTTTATTAAAGGAGCCAGGTGGG - Intergenic
1190072945 X:47293695-47293717 CTTACTTTAAGGGTTCAGGGCGG + Intergenic
1190785831 X:53647692-53647714 CTTTCTCATATGGGCAAGGGTGG - Intronic
1191880454 X:65839632-65839654 CTTTCTTAGAGGGTCTAGGTTGG - Intergenic
1193998175 X:88392273-88392295 CTTGCTTAAAGTGGCCACAGGGG + Intergenic
1194717736 X:97306380-97306402 CTTACAGAAAGGGGCCAGGAAGG - Intronic
1196756050 X:119158280-119158302 CTTTCATAAAGGGGTATGGGAGG + Intergenic