ID: 1166200915

View in Genome Browser
Species Human (GRCh38)
Location 19:41237594-41237616
Sequence CCATGCACTGTGGCATCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166200915 Original CRISPR CCATGCACTGTGGCATCCTT TGG Intronic
900353848 1:2250379-2250401 CCATGGACAGTGGCATACCTGGG - Intronic
900490002 1:2943172-2943194 CGATGCAATGTGGCATCTCTTGG + Intergenic
901861476 1:12077452-12077474 CTAGGGACTGTGGCATCCTTTGG - Intronic
904000593 1:27336337-27336359 CCCTGCTCTGTGGATTCCTTTGG + Exonic
904562910 1:31410733-31410755 CCATGCCCCATGCCATCCTTGGG - Intronic
905341488 1:37281311-37281333 AATTGCACTGTGGCATCATTAGG + Intergenic
905401119 1:37704075-37704097 CCAGGCATGGTGGCATGCTTGGG - Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
908425434 1:64002756-64002778 CCTTGTGCTGTGCCATCCTTTGG + Intronic
909670135 1:78179082-78179104 GAATTCACTGTGGCATCCCTGGG - Intergenic
909675888 1:78238718-78238740 CCTTGGATTTTGGCATCCTTGGG + Intergenic
912135208 1:106652660-106652682 CCATGGACTTTGGTATCCTTGGG - Intergenic
913338935 1:117737508-117737530 CCAGGCATGGTGGCATCCATGGG - Intergenic
915708621 1:157871542-157871564 ACCTGCACTGTGGCCTCCCTTGG - Intronic
916357719 1:163931756-163931778 CCATCCTCTCTAGCATCCTTAGG - Intergenic
921211197 1:212900118-212900140 CCATCCAATGTGGCATGCTTGGG - Intergenic
922922866 1:229322064-229322086 CCATGGAGTTTGGCATCCTAAGG + Exonic
924690559 1:246345932-246345954 CCCTGGACTGTGGCATTCATAGG - Intronic
924745905 1:246833476-246833498 CTATTCACTATGGCATCCTGTGG + Intergenic
1063122729 10:3115864-3115886 AGATGCCCTGTGGCATCCCTGGG + Intronic
1064453622 10:15466651-15466673 CCATTCACTTGAGCATCCTTAGG + Intergenic
1069578147 10:69545147-69545169 ACTAGCACTGTGCCATCCTTGGG - Intergenic
1071388492 10:85146101-85146123 GCATGCACTTTGTCCTCCTTTGG - Intergenic
1072723055 10:97792514-97792536 CCAGGCACTGTGGTAGCCCTGGG + Intergenic
1073287293 10:102396579-102396601 CAATCCCCTGTGGCCTCCTTCGG - Intronic
1073345280 10:102778193-102778215 CCCTGCAGTGTTGCATCCTTTGG - Intronic
1074241881 10:111647856-111647878 CCATGCACTTTGTCATTCTTTGG + Intergenic
1076933749 10:133553531-133553553 CCCTTCACTGAGGCAGCCTTTGG + Intronic
1078432155 11:11296412-11296434 GAATGCACTGTGACCTCCTTAGG + Intronic
1079469901 11:20768388-20768410 CTATGCTCTCTGGCCTCCTTTGG - Intronic
1080176205 11:29365865-29365887 CCAAACACTGTGGCACACTTGGG - Intergenic
1082073885 11:47961590-47961612 CCTTTCAGTGTGGCAGCCTTTGG + Intergenic
1083202926 11:61131311-61131333 CCATGCACTGTGGCAGGGGTTGG - Exonic
1085677350 11:78536133-78536155 CCATGCTCTGTGACATCACTAGG - Intronic
1085910131 11:80814309-80814331 CCATGGATTTTGGCATCCATAGG - Intergenic
1088751673 11:112847357-112847379 CCAGGCACTGTGCCAGCCATTGG + Intergenic
1088837983 11:113594786-113594808 CCATGGATTTTGGTATCCTTGGG + Intergenic
1089438162 11:118489320-118489342 CCATGGACTTTGGTATCCTCTGG + Intronic
1089474581 11:118748287-118748309 TCATGAACTGTGACAACCTTTGG + Exonic
1089604608 11:119634674-119634696 CCAAGCACTGTGCCATCCTTGGG - Intronic
1091117556 11:133028285-133028307 TCAGGCACTGTGGCAGCCTGGGG + Intronic
1092890384 12:12964314-12964336 CCATGCTCTTTGGCATCTTAGGG - Intergenic
1093954282 12:25198186-25198208 CCCTGGACTGGGGCATCCTCAGG + Intronic
1095129813 12:38527174-38527196 AAATGCACTGTGGTAACCTTAGG - Intergenic
1096458578 12:51808149-51808171 CCTTGCACTGGGTCAGCCTTTGG + Exonic
1096704839 12:53413675-53413697 TCATGTACTTTGGCATCTTTTGG + Intronic
1102471183 12:113160789-113160811 TGATTCCCTGTGGCATCCTTAGG - Intronic
1102824600 12:115937398-115937420 CCATGCTGTTTGGCTTCCTTAGG + Intergenic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1104189779 12:126469006-126469028 CCATGGACTGTGGACTCTTTAGG + Intergenic
1104798353 12:131535853-131535875 CCATGGATTCTGGCATCCTTGGG + Intergenic
1105289978 13:19047518-19047540 GGAGGCACTGTGGCATCCCTGGG - Intergenic
1105573843 13:21630442-21630464 CCATGAATTTTGGCATCCTTAGG - Intergenic
1105820425 13:24076436-24076458 CCAGGCACTTGGCCATCCTTTGG - Intronic
1106136649 13:26978608-26978630 TCAGGCACTGTGGCTTCCTGAGG - Intergenic
1106591458 13:31102145-31102167 GCATTCACTGTGCCATCCTTTGG + Intergenic
1107147958 13:37079837-37079859 CCATGGATTTTGGTATCCTTGGG + Intergenic
1111296136 13:86280213-86280235 CCATGAATTGTGACAACCTTTGG - Intergenic
1113138641 13:107122011-107122033 TCATTCACTGTGGTATCTTTTGG - Intergenic
1113815769 13:113169942-113169964 CCAGCCACTGTGGCCTCCCTGGG + Intronic
1114415007 14:22536908-22536930 CCATGCACAGCCGCATTCTTTGG + Intergenic
1114499528 14:23157939-23157961 CCAGGCACTGTGGCAGGCATGGG - Intronic
1114670380 14:24407927-24407949 TCCTGCACTGTGCCTTCCTTGGG + Exonic
1117579845 14:57141616-57141638 CCATGGATTTTGGTATCCTTGGG + Intergenic
1121615761 14:95312376-95312398 CCAGGCAGTCTGGCACCCTTTGG + Intronic
1121631737 14:95426244-95426266 CCATGCTCTGTGTCATCCCACGG - Intronic
1121788872 14:96683833-96683855 GCCTTCACTGTGGCTTCCTTAGG - Intergenic
1124231201 15:27947637-27947659 ACATGCACTCTGGCATCCCACGG + Intronic
1124554403 15:30711449-30711471 GCATGCTCTCTGGCATCCCTCGG - Intronic
1124621954 15:31278953-31278975 CTCTGCACTGTGGCTGCCTTGGG + Intergenic
1124676843 15:31694228-31694250 GCATGCTCTCTGGCATCCCTCGG + Intronic
1129867149 15:78917929-78917951 CCAGGCTCTGTAGCATCCTTAGG + Intergenic
1130574718 15:85081652-85081674 CCATGCCCTGTGGGATCCTTGGG + Intronic
1131045076 15:89307973-89307995 CCATGCCATGAGGCATCCTCTGG + Intronic
1131780133 15:95846977-95846999 CCAAGCAGTGTGGCTCCCTTGGG - Intergenic
1136399374 16:30009484-30009506 CTCTGCACTGTAGCATCCTCAGG - Exonic
1138240658 16:55424676-55424698 CCATGCACAGGGGCATCCGGAGG - Intronic
1139471341 16:67179621-67179643 CGCTGCCCTGTGGCATCATTGGG - Intronic
1142260248 16:89039509-89039531 CCCTGCCCCGTGGCCTCCTTGGG + Intergenic
1143740985 17:8953866-8953888 CCAAGGACTGTGGCAGCCCTAGG - Intronic
1144265492 17:13564423-13564445 CCATGGATTTTGGTATCCTTAGG - Intronic
1145759243 17:27416547-27416569 CCATGGATTTTGGCATCCCTGGG - Intergenic
1147868763 17:43572378-43572400 CCAGGCACGGTGGCTTACTTGGG - Intronic
1149122925 17:53191350-53191372 AGATGCACTGTGGTATCGTTTGG - Intergenic
1152090136 17:78241830-78241852 CCATGCACTGTCTCTTCCCTGGG - Intergenic
1157158885 18:45294555-45294577 ATATGCAATGTGGCATGCTTGGG + Intronic
1159959180 18:74542049-74542071 CCATGCACTCTGGGATCCCAGGG - Intronic
1160594098 18:79962434-79962456 CCCTGTACTGTGGCATCTTCTGG + Intergenic
1160947113 19:1648797-1648819 CCATGCCCAGTGGCAGCGTTTGG - Intronic
1162245468 19:9396342-9396364 CCAGGCACAGTGGCACACTTTGG + Intergenic
1162316174 19:9939470-9939492 CCATGAACAGTGTCCTCCTTGGG + Intergenic
1162513603 19:11134884-11134906 CCAGGCACTGTGGCAGCCCACGG - Intronic
1166200915 19:41237594-41237616 CCATGCACTGTGGCATCCTTTGG + Intronic
1167378835 19:49127006-49127028 ACAGGCACAGTGGCATACTTTGG + Intronic
927351502 2:22122766-22122788 ACATGCACAGTGGCCTGCTTGGG - Intergenic
928130445 2:28645232-28645254 CCATGGACTGTGGCTTCCTCAGG - Intergenic
928848409 2:35709259-35709281 CCAAGCACTGTGGAAGCCTGAGG - Intergenic
929505107 2:42522316-42522338 CAGAGCACTGTGGCATCCCTGGG + Intronic
932389401 2:71372359-71372381 CCATGCACTGAAGGAGCCTTTGG - Intronic
932671358 2:73740396-73740418 CCATGCACTCTGTCATCCACAGG - Intergenic
935870351 2:107441339-107441361 CCATGCTCTGGGGCACCGTTGGG + Intergenic
940459936 2:153952195-153952217 AGGTGCACTGTGGCATCATTGGG - Intronic
941006427 2:160251744-160251766 CCATGCACTGTGGCCAGGTTGGG + Intronic
942080115 2:172392489-172392511 CCAAGCACTGTGGCTCCTTTAGG + Intergenic
944883355 2:204038395-204038417 CCATGCACCTTGGCATCATGGGG - Intergenic
948147303 2:235717122-235717144 CCATGCATGGTAGCATCTTTAGG - Intronic
1171453723 20:25254458-25254480 CCATGCAGAATGGCATTCTTAGG + Intronic
1175881572 20:62262417-62262439 CCATGCAGGGTCGTATCCTTGGG + Intronic
1177045194 21:16160397-16160419 CCCAGCACTGTGGGAGCCTTAGG + Intergenic
1177664360 21:24134470-24134492 CCATGCACAGTAGTATCCTAGGG - Intergenic
1179632496 21:42687277-42687299 CCATGGTCTGGGGCATCTTTGGG + Intronic
1182388468 22:29968733-29968755 CCATGCACTGTTGTAGACTTTGG - Intronic
1183057496 22:35315835-35315857 GCAGGCACTGTGGCTTCTTTTGG + Intronic
1184147280 22:42619118-42619140 CCAAACACTGAGGCAGCCTTGGG - Exonic
1184198712 22:42950293-42950315 CCATGGATTTTGGTATCCTTTGG + Intronic
949648581 3:6128189-6128211 CCAGGCACTGTGGCATGCACCGG + Intergenic
950495012 3:13328527-13328549 CCATGCCCTGTTTCCTCCTTTGG + Intronic
951864942 3:27297812-27297834 ACAGCCACTGTGGCAGCCTTTGG + Intronic
956086869 3:65620750-65620772 CCATGGACAGAGGCAACCTTGGG + Intronic
957345616 3:78957656-78957678 TCATGCCCTGTGTGATCCTTAGG + Intronic
957568862 3:81920015-81920037 CCCTGCAGTGTGGCATCCTGTGG + Intergenic
958806064 3:98811906-98811928 TCAGGCACTGTGGTAGCCTTTGG + Intronic
958889370 3:99766366-99766388 CCAATCACTGAGGCATACTTGGG + Intronic
962372971 3:134835871-134835893 CCCTGCCCTGTGGGGTCCTTTGG + Intronic
963359887 3:144257971-144257993 CCATTCACTGTGTCTTCCCTTGG - Intergenic
966898409 3:184462975-184462997 CCATGGATTTTGGCATCCATAGG + Intronic
969429123 4:7143652-7143674 GCATGCACTGTGGAGTCCTGAGG + Intergenic
970506530 4:16736006-16736028 CCAGACACTGTGGCATCTATAGG - Intronic
972463619 4:39330205-39330227 CCAGGCACTGTGTTATCCTTAGG + Intronic
979715234 4:123829748-123829770 TCATTTACTGTGGCAACCTTAGG + Intergenic
983800654 4:171925246-171925268 TCAGGCACTGCGACATCCTTAGG - Intronic
986183984 5:5419437-5419459 CCATCCTCTGGGGCATCCTAGGG - Intergenic
986445744 5:7819697-7819719 CCATGCACTGTGACATCCAGAGG + Intronic
987006986 5:13720786-13720808 CCATCCACTTTGCTATCCTTGGG + Intronic
988291893 5:29297750-29297772 CCATGAAGTGTTGCATACTTAGG - Intergenic
990333351 5:54748712-54748734 CCATGCATTGTGGCTCCCTTTGG - Intergenic
990628323 5:57639898-57639920 CCATGCACAGTGTCCTGCTTTGG - Intergenic
990802790 5:59624238-59624260 CCATCCCCTGTTCCATCCTTTGG + Intronic
992084235 5:73263693-73263715 CCAGGCACTGTTACATGCTTGGG - Intergenic
992410656 5:76502202-76502224 ATAGTCACTGTGGCATCCTTGGG + Intronic
994063982 5:95514039-95514061 CCATTCACTGTGGTAGCATTTGG - Intronic
995420848 5:111965040-111965062 TCTTCCACTGTGCCATCCTTAGG + Intronic
996259206 5:121445504-121445526 CCATGCACTGAGGGAGCATTTGG + Intergenic
1000350966 5:160352534-160352556 CCATGTACTGGGGCTGCCTTTGG - Intronic
1002184738 5:177448899-177448921 CCATGCACTGCTGCAGCCTGTGG + Intronic
1004129278 6:12903410-12903432 CCTTGCAGTGAGGCAACCTTTGG - Intronic
1007475739 6:42118677-42118699 CCCTGCACTGTGGCTGCCTGGGG + Intronic
1007966105 6:46005031-46005053 CCATGCACACTGGCAGCATTAGG + Intronic
1008065617 6:47044697-47044719 TTATGCACTGTGGCAGCATTCGG + Intergenic
1010515925 6:76772519-76772541 CCATACACTTTGTCATCCTCAGG + Intergenic
1011350152 6:86414246-86414268 CCATGGATTTTGGTATCCTTGGG - Intergenic
1011618669 6:89221624-89221646 CCATGGATTTTGGAATCCTTGGG + Intronic
1014945306 6:127490566-127490588 CCAAGCACTTTGGGAGCCTTAGG + Intronic
1016453662 6:144209704-144209726 CCCTGCACTGTAGCTTCCTCTGG - Intergenic
1017152343 6:151291765-151291787 CTATACACTGTGGCATCCATCGG - Intronic
1019205282 6:170356572-170356594 GCATGGATTTTGGCATCCTTGGG - Intronic
1020691288 7:11357653-11357675 GCATGTGCTGGGGCATCCTTCGG + Intergenic
1021067243 7:16191555-16191577 GCAAGCACTGTGCTATCCTTCGG - Intronic
1021762208 7:23913150-23913172 ACATGCCCTGTAGCATCATTAGG - Intergenic
1022438543 7:30413161-30413183 CCATGCACGGTTGAATCCTTTGG + Intergenic
1023772579 7:43571806-43571828 CCCTGCACTTTGGGATCCTGAGG + Intergenic
1024112350 7:46160150-46160172 CCTTGCAGTGTGGCATGCTTTGG - Intergenic
1024248112 7:47485626-47485648 CCATGGGCTGTGGCATCCCCGGG + Intronic
1026275752 7:68874722-68874744 CAGTGCACAGAGGCATCCTTGGG - Intergenic
1027805089 7:82809309-82809331 CCATTCACTCTGGCTCCCTTTGG + Intronic
1029508941 7:100981264-100981286 ACTTGCTCTGTGACATCCTTTGG + Intronic
1029926108 7:104319433-104319455 CCATGCACTGTTCCATGCTTTGG + Intergenic
1031625378 7:123986400-123986422 CAATACACTGTGGCCTCATTAGG + Intergenic
1033099362 7:138457381-138457403 CCAGGCACAGTGGCTTGCTTAGG - Intergenic
1037682505 8:21109290-21109312 ACAGTCACTGTTGCATCCTTGGG + Intergenic
1038176845 8:25187953-25187975 TCCTGGACTGTGCCATCCTTGGG + Intronic
1039385697 8:37133877-37133899 GCATTCACTGAGGCTTCCTTAGG - Intergenic
1039517795 8:38147859-38147881 CAGTGCACTTTGGCATCGTTGGG + Intronic
1042885726 8:73548071-73548093 CCATGAACTTTGGTATCTTTGGG + Intronic
1043908939 8:85837953-85837975 CCAGGCTTTGTGGCCTCCTTGGG - Intergenic
1048539207 8:135327173-135327195 GCCTCCACTGTGACATCCTTTGG - Intergenic
1050083734 9:1942171-1942193 GCATTCCCTCTGGCATCCTTAGG + Intergenic
1052815542 9:33100154-33100176 CCATGCCCTGGGGGATCCCTCGG + Intergenic
1059783837 9:117558773-117558795 CCATGCACTCTTGCATCCTCAGG - Intergenic
1059862247 9:118477758-118477780 CCATTCACTTGGTCATCCTTTGG + Intergenic
1060265244 9:122108304-122108326 CCTTGCTCCGTGGCTTCCTTTGG - Intergenic
1061385255 9:130285768-130285790 GCCTGCTCTTTGGCATCCTTGGG + Intronic
1062311139 9:135938066-135938088 CCATGCAGGTTGGCATCCTGCGG - Intronic
1192994031 X:76493062-76493084 CCATGCACTTTGCCATGCTGTGG - Intergenic
1194073875 X:89363853-89363875 CCAAGCACTGTGTTATCATTTGG - Intergenic
1195226323 X:102797951-102797973 CCATGAACTGTTCCATCATTAGG + Intergenic
1197644907 X:129006739-129006761 TCTTTCACTGTGGCATCCCTGGG + Intergenic
1200729260 Y:6715407-6715429 CCAAGCACTGTGTTATCATTTGG - Intergenic
1201774775 Y:17650474-17650496 CCCTGCACTTTGGGATCCTGAGG - Intergenic
1201826781 Y:18255515-18255537 CCCTGCACTTTGGGATCCTGAGG + Intergenic
1202069824 Y:20979351-20979373 CCAAGCACTGTGGGACCCTGAGG - Intergenic