ID: 1166204788

View in Genome Browser
Species Human (GRCh38)
Location 19:41262685-41262707
Sequence CCACTACGGTCCGCAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166204788_1166204794 -2 Left 1166204788 19:41262685-41262707 CCTGCCTCTGCGGACCGTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1166204794 19:41262706-41262728 GGGCACATCTACACTGCAGCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1166204788_1166204796 21 Left 1166204788 19:41262685-41262707 CCTGCCTCTGCGGACCGTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1166204796 19:41262729-41262751 GTGCCTTACCCAAAGCAGATCGG 0: 1
1: 0
2: 0
3: 5
4: 94
1166204788_1166204801 29 Left 1166204788 19:41262685-41262707 CCTGCCTCTGCGGACCGTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1166204801 19:41262737-41262759 CCCAAAGCAGATCGGAATTGGGG 0: 1
1: 0
2: 2
3: 17
4: 379
1166204788_1166204799 28 Left 1166204788 19:41262685-41262707 CCTGCCTCTGCGGACCGTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1166204799 19:41262736-41262758 ACCCAAAGCAGATCGGAATTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1166204788_1166204798 27 Left 1166204788 19:41262685-41262707 CCTGCCTCTGCGGACCGTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1166204798 19:41262735-41262757 TACCCAAAGCAGATCGGAATTGG 0: 1
1: 0
2: 0
3: 4
4: 88
1166204788_1166204795 -1 Left 1166204788 19:41262685-41262707 CCTGCCTCTGCGGACCGTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1166204795 19:41262707-41262729 GGCACATCTACACTGCAGCGGGG 0: 1
1: 0
2: 2
3: 33
4: 773
1166204788_1166204793 -3 Left 1166204788 19:41262685-41262707 CCTGCCTCTGCGGACCGTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1166204793 19:41262705-41262727 TGGGCACATCTACACTGCAGCGG 0: 1
1: 0
2: 2
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166204788 Original CRISPR CCACTACGGTCCGCAGAGGC AGG (reversed) Intronic
901055948 1:6448658-6448680 CCACGACGGGCTGCGGAGGCAGG + Exonic
902290254 1:15430623-15430645 GCACTTCGGTCGGCCGAGGCGGG + Intergenic
906263805 1:44412949-44412971 CCACTAGGGTCCGGAGAGAAAGG - Intronic
907388024 1:54138388-54138410 CCACTAAGGCCCGAAGGGGCTGG + Intronic
910858137 1:91716671-91716693 CCACTACTGTCCCCAAGGGCTGG + Exonic
916676684 1:167069787-167069809 TCACTACAGTCCTGAGAGGCAGG - Intronic
924236116 1:242000847-242000869 CCTCTACCCTCCCCAGAGGCTGG + Intergenic
1062885914 10:1015825-1015847 CCACTCCGGGCCACAGAGGACGG - Exonic
1072676241 10:97468460-97468482 CCCCTACAGTCCACAGAGGTTGG + Intronic
1083829917 11:65225110-65225132 GCACTACGGGAAGCAGAGGCGGG + Intergenic
1084173182 11:67410278-67410300 CCACTCCTGTCCCCAGAGGCTGG - Intronic
1088054213 11:105555634-105555656 CCTCTACATTCCCCAGAGGCTGG - Intergenic
1089404683 11:118187674-118187696 CCAGGCTGGTCCGCAGAGGCTGG + Intergenic
1102051296 12:109864037-109864059 CCACCATGGTCAGCAGAAGCTGG + Intronic
1107409810 13:40148214-40148236 CCACTTCAGTCAGGAGAGGCTGG + Intergenic
1119556209 14:75554972-75554994 GCACTTCAGTCCTCAGAGGCAGG - Intergenic
1124375920 15:29128563-29128585 CCACTACAGTCAGCATATGCAGG - Intronic
1125743511 15:41983792-41983814 CCACTGCGAGCCGCAGAGCCTGG + Exonic
1131823587 15:96297317-96297339 CCACTACCTTGGGCAGAGGCTGG + Intergenic
1135787815 16:25366243-25366265 CCACTTAGGTCCGTAGAGGGAGG + Intergenic
1141890879 16:86925759-86925781 CCTCTAGGTTCCGCAGAGTCTGG + Intergenic
1142156599 16:88535246-88535268 CCACTGCGGCCCGGAGTGGCTGG + Exonic
1142219020 16:88843938-88843960 ACAGGCCGGTCCGCAGAGGCAGG + Intronic
1143032142 17:3973787-3973809 CCACTACTGTGTGCAGGGGCTGG - Intergenic
1148482274 17:47967821-47967843 CCTCTGCAGTCAGCAGAGGCAGG + Intronic
1149295268 17:55256447-55256469 CCAGTACGGTCTACACAGGCAGG - Intergenic
1149739689 17:59033542-59033564 CCACTACGGGAGGCTGAGGCAGG - Intronic
1155575520 18:27241839-27241861 CCACTACGGGAAGCCGAGGCAGG + Intergenic
1158867143 18:61648921-61648943 CCACTTTGGTGGGCAGAGGCAGG - Intergenic
1160568726 18:79802350-79802372 CCGCTCCGGTCCGGAGAGCCTGG + Intergenic
1160568748 18:79802442-79802464 CCGCTCCGGTCCGGAGAGCCTGG + Intergenic
1165226063 19:34356031-34356053 CCACTGCGGCCGGCAGAGACAGG - Intergenic
1166204788 19:41262685-41262707 CCACTACGGTCCGCAGAGGCAGG - Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1168326506 19:55541256-55541278 CCACGGCTGGCCGCAGAGGCAGG + Exonic
929501461 2:42494203-42494225 CCACTACGGGCCGGAGCGGAGGG - Intergenic
932142936 2:69295478-69295500 ACACTTTGGTACGCAGAGGCGGG + Intergenic
932360992 2:71105496-71105518 CCACTGCGCTCTGCCGAGGCTGG + Intergenic
939194426 2:138954709-138954731 CCACTCGGGACCTCAGAGGCAGG - Intergenic
941121129 2:161531703-161531725 CCACCACAGTCCGCAGAGTGTGG - Intronic
947460987 2:230305394-230305416 CCACTACTGACGGCAGCGGCAGG + Intronic
947873020 2:233450147-233450169 ACACGACGGTGCGCAGAGGGAGG - Intronic
948591317 2:239052560-239052582 CCGCTATGGTTCACAGAGGCGGG + Exonic
1169966692 20:11225574-11225596 CCACGAAGGTGCTCAGAGGCTGG - Intergenic
1173809274 20:45946445-45946467 ACACTACAGCCAGCAGAGGCGGG - Intronic
1176179878 20:63744789-63744811 CCAAAACGGTCAGCAAAGGCAGG + Exonic
1181849724 22:25741546-25741568 CCTCTACGGCCCGCACAGCCTGG + Intergenic
1184193953 22:42914175-42914197 CCACTAGGATTCACAGAGGCTGG + Intronic
1185413396 22:50697449-50697471 CCACCACCGCCCGCAGAGGGAGG + Intergenic
950669972 3:14520109-14520131 CCACTGAGGCCCTCAGAGGCAGG - Exonic
954262699 3:49451115-49451137 CCACTACGGGAGGCAGAGGTGGG + Intergenic
961532538 3:127548009-127548031 CCCCTACGGCCTCCAGAGGCCGG + Intergenic
968691666 4:1993333-1993355 GCACTTCGGCCGGCAGAGGCGGG + Intronic
969436779 4:7193216-7193238 CCACTATGGTCATCAGGGGCGGG + Intronic
970393541 4:15641778-15641800 CCACTTTGGGACGCAGAGGCAGG + Intronic
973712410 4:53642865-53642887 CCATAACGGTCCTCAGAGGGTGG - Intronic
979738289 4:124117513-124117535 TCACCACGCTCCGCAGGGGCAGG - Intergenic
1004316202 6:14590170-14590192 TCACTAAGGTCCCCAAAGGCAGG - Intergenic
1015724835 6:136289522-136289544 GCACTACGGGCCGAAAAGGCCGG - Intronic
1024457488 7:49626102-49626124 CCACTACAGTCCCCATAGGTGGG + Intergenic
1035643278 8:1199943-1199965 CCACAACCCCCCGCAGAGGCCGG + Intergenic
1057610871 9:96542721-96542743 CCACTGCGCCCGGCAGAGGCCGG - Intronic
1186863976 X:13701016-13701038 ACACTACGGGAGGCAGAGGCAGG - Intronic
1199196824 X:145041736-145041758 CCTCTAGGTTCTGCAGAGGCTGG - Intergenic