ID: 1166205696

View in Genome Browser
Species Human (GRCh38)
Location 19:41267332-41267354
Sequence CTGGGGAAAAGAGGCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166205690_1166205696 2 Left 1166205690 19:41267307-41267329 CCTCTGTGAACACAGGAGAGAGA 0: 1
1: 0
2: 4
3: 33
4: 383
Right 1166205696 19:41267332-41267354 CTGGGGAAAAGAGGCTTTGTGGG 0: 1
1: 0
2: 1
3: 32
4: 259
1166205688_1166205696 15 Left 1166205688 19:41267294-41267316 CCAGGAGGGGCTGCCTCTGTGAA 0: 1
1: 0
2: 4
3: 33
4: 219
Right 1166205696 19:41267332-41267354 CTGGGGAAAAGAGGCTTTGTGGG 0: 1
1: 0
2: 1
3: 32
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166205696 Original CRISPR CTGGGGAAAAGAGGCTTTGT GGG Intronic
900369714 1:2326235-2326257 GTGGGGAGAACAGGCTTTGCCGG + Intronic
903030641 1:20461856-20461878 CTGGGGAAAAGAGGACTCTTAGG + Intergenic
903580869 1:24369671-24369693 CACGGGAAAAGAGTCTTTTTTGG + Exonic
904021006 1:27465559-27465581 CAGGGGAAGATAGGTTTTGTGGG - Intronic
904074578 1:27830574-27830596 CAAAGGAAAAGGGGCTTTGTAGG - Intergenic
904129004 1:28261682-28261704 CTAGGGAGAAAAGGCTTTGAGGG + Intronic
904313254 1:29642898-29642920 CTGGGGAAATGAAGCTATCTGGG - Intergenic
905198607 1:36301022-36301044 CTGGGGACCAAAGACTTTGTGGG + Exonic
907463931 1:54622845-54622867 ATGGGGGAATGAGGCTTGGTGGG + Intronic
908028084 1:59971855-59971877 CTGGGGAAAAGAGGATTCGAGGG + Intergenic
911227525 1:95323287-95323309 CTGGGGACAAAAGGCTCTGGTGG + Intergenic
911549918 1:99265801-99265823 CTTGGGAGAAGAGACATTGTCGG + Intronic
912494209 1:110080811-110080833 CTGGGGAAAAGCAGCTCTGTAGG + Intergenic
912958329 1:114172263-114172285 CTGGGGAAGAGAGGTTTTGGTGG + Intergenic
918103946 1:181400526-181400548 CAGGAGACAAGAGGCTTGGTAGG - Intergenic
920898737 1:210084966-210084988 CTGGAGAAAGGAAGCTCTGTTGG + Intronic
922160283 1:223074619-223074641 CAGAGGAAAAGGGGCTTTGTGGG + Intergenic
923688872 1:236174194-236174216 CTTAGGAAAGGAGGCTGTGTTGG - Intronic
1064381203 10:14843248-14843270 CTGGTGGAAAGAGGCTTTCCAGG + Intronic
1065136231 10:22673110-22673132 ATGGGGATCAGGGGCTTTGTAGG - Intronic
1065188362 10:23190352-23190374 CTCTTGAAAAGAGACTTTGTAGG + Intergenic
1066550278 10:36548263-36548285 CAGGACAAAAGAGGGTTTGTGGG - Intergenic
1067788756 10:49272014-49272036 CTGGGAAAAAGAGTCCTTGCAGG + Intergenic
1068646912 10:59478423-59478445 TTGCAGAGAAGAGGCTTTGTTGG - Intergenic
1069497184 10:68916053-68916075 ATGGTAAAAAGAAGCTTTGTGGG + Intronic
1070398525 10:76033140-76033162 CTGGGGAAGATAGGTTTTGGGGG - Intronic
1070449995 10:76548531-76548553 CTGGGGAGGAGAGGGGTTGTTGG + Intronic
1070910101 10:80110349-80110371 CTGTGGGAAAGCGGCTTTGTTGG - Intergenic
1071511841 10:86266941-86266963 CTTGGGGACAGAGGCTCTGTGGG - Intronic
1074390566 10:113054102-113054124 TTGAGGAAGTGAGGCTTTGTGGG + Intronic
1075826780 10:125363840-125363862 CTCTGGAAATGAGGCTTTGAAGG - Intergenic
1078328306 11:10398199-10398221 CTTGGCAGAAGAGGCTTTGGGGG + Intronic
1078761524 11:14255651-14255673 CTGGGGAATGGTGGGTTTGTTGG - Exonic
1083643190 11:64156692-64156714 CTGGAGAGAAGGGGCTTTGTGGG - Intronic
1083964639 11:66035875-66035897 CTGGGGAGAAGAGGATTGGCTGG + Intergenic
1084180946 11:67445554-67445576 GTGGGGAAAGGAGCCTTTTTGGG - Intergenic
1084648058 11:70472268-70472290 ATGGGGAAAAGAATCTGTGTAGG + Intronic
1085278571 11:75315458-75315480 CTGTGGACTGGAGGCTTTGTTGG - Intronic
1085340201 11:75726340-75726362 ATGTGGGAATGAGGCTTTGTAGG - Intronic
1089207923 11:116779881-116779903 CTGGTAAAAAGAGGCTATGTCGG + Intronic
1089404525 11:118186575-118186597 CTGTGGATAAGAAGGTTTGTAGG + Intergenic
1090015133 11:123079360-123079382 GTGGGGAAAAAAGGATTTTTGGG + Intronic
1091297331 11:134483159-134483181 CTGGTGAAAGGAAGCTTTGATGG - Intergenic
1092861650 12:12724480-12724502 CTGGGGAAATGTGGGTTTGGGGG + Intergenic
1092919029 12:13214508-13214530 CAGGGGAAAAGGAGATTTGTCGG - Intronic
1093391287 12:18626673-18626695 CTGGGTAAAATAGTCTTGGTTGG + Intronic
1095215184 12:39539501-39539523 CTGAGGAAAAGAGTCTCAGTGGG - Intergenic
1095413221 12:41946590-41946612 AGGGGGAAAAATGGCTTTGTGGG - Intergenic
1096096808 12:48940854-48940876 CTGGGGAGAAGAGGCCAGGTTGG + Intronic
1096189427 12:49605634-49605656 CTGGGGAAAAGAGGATCAGTTGG - Exonic
1096637789 12:52972137-52972159 CTGGAGAAAAGAAGCTTGGGAGG + Intergenic
1099172572 12:79382311-79382333 CTGGGGAAAATAGTCTTTCAGGG - Intronic
1102546936 12:113664137-113664159 CTGAGAAAAAGAGGCTGAGTTGG + Intergenic
1102689561 12:114749821-114749843 CTGTAGAAAAGAGAATTTGTGGG - Intergenic
1103088539 12:118080864-118080886 CTGGGGAAAAGAGGGAATGAGGG + Intronic
1103996450 12:124833510-124833532 CTCAGCAAAAGTGGCTTTGTAGG - Intronic
1104575198 12:129960249-129960271 CTGGGGAAAAGAGAAGATGTGGG - Intergenic
1109414520 13:62020776-62020798 TTGGGGAAAAGAAAATTTGTAGG - Intergenic
1110333998 13:74305068-74305090 CTGGGGAAAAGAGAATGAGTGGG - Intergenic
1110595029 13:77310909-77310931 GTGGGGAAAATAGGCTGTTTTGG - Intronic
1111422202 13:88027040-88027062 GTGTGGAAAAGGGGCTTGGTAGG + Intergenic
1113162746 13:107400899-107400921 CTGGGGAAAAGTGTGTATGTGGG - Intronic
1113482821 13:110634205-110634227 CTTGGGAAAAGTGTCTTAGTCGG + Intronic
1114860740 14:26517368-26517390 AGGAGGAAAAGAAGCTTTGTAGG - Intronic
1115471291 14:33771194-33771216 CTGAGGAAAAAAAGCTCTGTTGG + Intronic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1117356787 14:54931953-54931975 CTGGGGATATGAGGCCTTGGGGG - Intergenic
1117992663 14:61449680-61449702 CTGAGGAAAAGAGAGATTGTAGG - Intronic
1121538141 14:94705510-94705532 CTGGGAAAAAGGTGCTTTGAGGG - Intergenic
1121636151 14:95455149-95455171 TTGGGGAAAAAAGTCTCTGTAGG + Intronic
1122793941 14:104196441-104196463 CTGGGGAGAAGGTGCTTTGGAGG + Intergenic
1123886403 15:24731979-24732001 GATGGGAAAAGAGTCTTTGTTGG + Intergenic
1124126058 15:26939019-26939041 GTGGGGAGAACAGGCTTTGGGGG - Intronic
1127191809 15:56539256-56539278 GTTGGGAAAAGAAGCATTGTTGG - Intergenic
1128590200 15:68888586-68888608 CTGGGAAAAAGAGCTTTTGGGGG + Intronic
1129831635 15:78674763-78674785 TTGGGGAAAAGGGTCTTTGTAGG + Intronic
1130299023 15:82666236-82666258 CTTGGGAAAAGAGGCCTTAAGGG + Intronic
1131976931 15:97956282-97956304 CTGGTCAAAAGATGGTTTGTTGG + Intergenic
1132638428 16:965582-965604 CTGAGGGAAAGTGGCTTTGATGG + Intronic
1133071028 16:3246857-3246879 CTGGGCACAAGAGGCACTGTGGG + Intronic
1133426104 16:5690994-5691016 CTGGGGTAAAGAGGATTATTGGG - Intergenic
1133957237 16:10455174-10455196 ATGGTGAAAAGAGTCTTTGTAGG + Intronic
1133983843 16:10653106-10653128 CTGGGGAAAAGAGGCTTCTGGGG + Intronic
1135651391 16:24209565-24209587 GTGAGGAAGAGAGGCATTGTTGG - Intronic
1135866242 16:26105047-26105069 GTGGGGAGAAGAGGCTTTCGGGG - Intronic
1137384902 16:48032431-48032453 CTGGGGAAAAGACTCTCAGTAGG - Intergenic
1138103734 16:54275476-54275498 CTGGTGGAAGGAGGCTTTGGGGG - Intergenic
1138141498 16:54572460-54572482 GTGGGGAACAGAGGATTTTTAGG - Intergenic
1140449986 16:75063187-75063209 CTGGGGAAGCGGGGCTATGTGGG - Intronic
1140662399 16:77199932-77199954 CTGGAGAAAAGAGGCTGTGGGGG - Exonic
1141351733 16:83304328-83304350 CTTGGGAAAAAAGACTGTGTTGG + Intronic
1143047582 17:4094631-4094653 CTGGGGAAAAACAGGTTTGTGGG - Intronic
1143540814 17:7567683-7567705 CTGAGGAACAGAGGGCTTGTGGG + Intronic
1144321079 17:14120577-14120599 CTTAGGAAAAGCTGCTTTGTTGG + Intronic
1144704060 17:17355834-17355856 CAGAGGAAAAGAGTCTTTTTTGG - Intergenic
1146456487 17:33013435-33013457 TTGGGGAAAAGGGGGTTTTTGGG + Exonic
1146770989 17:35568440-35568462 CTGGGGAAATGAGGGCTTGGAGG + Intergenic
1147265451 17:39231787-39231809 CTTGGTAACAGATGCTTTGTGGG - Intergenic
1147436232 17:40417861-40417883 CTGTGGAGAAGCGGCTTGGTCGG - Exonic
1147784801 17:42971784-42971806 CTGGGGAAAAGAGGGTCAGTAGG + Intronic
1149027827 17:52050563-52050585 CTGGGAAGAAGAGGCCTTGTAGG - Intronic
1149310565 17:55388956-55388978 CTTGGGAAAGTAGGCTTTGGAGG - Intergenic
1150631371 17:66882683-66882705 CTGGGGAGAAGATGCTTGGATGG + Intronic
1152402814 17:80078799-80078821 CTGGGGAAAAAATGCCTTCTGGG + Intronic
1152621498 17:81367172-81367194 CTTGGGGAAAGGGGCATTGTGGG - Intergenic
1153022242 18:640126-640148 CTAGGGAAGAGATCCTTTGTTGG - Intronic
1154958207 18:21280670-21280692 CTGGAGAAAACAGGCTCTGAAGG - Intronic
1155250954 18:23952967-23952989 CTGGGGAAAGGAGGCTGGTTAGG - Intronic
1155276278 18:24190478-24190500 TTGAGTAAAAGAGGCTTTGCTGG - Intronic
1156837307 18:41569394-41569416 CTGGGCAAGAGAGGGTTTGCAGG + Intergenic
1156948704 18:42867189-42867211 CTGGTGACAACAGGCTTTGTGGG + Intronic
1157605219 18:48922187-48922209 CTGCAGAGAAGAGGCTTTGTTGG - Intronic
1157895420 18:51462113-51462135 TTGGGGAAGAGAGGCTTGGCAGG + Intergenic
1158101500 18:53834724-53834746 CTGAGGAAAACAGGTTTTGTTGG + Intergenic
1158636298 18:59161486-59161508 CTGGGCAAATGAAGCATTGTTGG + Intergenic
1161840075 19:6674768-6674790 CTTAGGAAAAGAGGCTGTGGAGG + Intergenic
1162348615 19:10135853-10135875 CTGGGGGAAAGAGGCGCGGTGGG + Intronic
1163262583 19:16200027-16200049 CTGGTCAAAAGAGGCTTTTATGG + Intronic
1164749606 19:30642852-30642874 CTGAGTGAAAGAGGCTGTGTGGG + Intronic
1166205696 19:41267332-41267354 CTGGGGAAAAGAGGCTTTGTGGG + Intronic
1166530849 19:43542722-43542744 CTTTGGCAAAGAGGCTTTGGGGG - Intergenic
1167853512 19:52219932-52219954 ATGGGGAAACGGGGCTTTGAAGG + Intronic
1168430586 19:56276328-56276350 CTGGGGAAGAGAGGCCTATTCGG + Intronic
925215825 2:2095211-2095233 CTGGGGAAAAGGGGCTTTCTGGG + Intronic
925640707 2:5983646-5983668 CTGGGGACAAAATGGTTTGTAGG + Intergenic
926363041 2:12108042-12108064 AGGGGGAAAAGAGGCTGTGGTGG - Intergenic
927763074 2:25778175-25778197 TTTGGGAAAAGAGCCTTGGTAGG + Intronic
927966756 2:27275255-27275277 CTGGGGAAGAGGGGCTCGGTGGG + Intronic
929812112 2:45199469-45199491 CTCTGGAAAAGGGCCTTTGTGGG + Intergenic
931739432 2:65228308-65228330 CTGGGGAAAAGAGCCCTTCTCGG - Intronic
932186233 2:69698600-69698622 CTGGGGACAAGCTGCGTTGTCGG + Intronic
932783977 2:74583420-74583442 GTGGGGTAATGAGGCTTTGCTGG + Intronic
932971979 2:76555027-76555049 GTGGGGTAAAGAGGCCTGGTAGG + Intergenic
933418829 2:82022660-82022682 CTGTGGGAAAGAGGGTTTCTGGG + Intergenic
937668301 2:124512222-124512244 CTGGGGAGAAGATGCTTTAATGG - Intronic
938210697 2:129463871-129463893 CTGGGGATCAGAGGGTTTCTTGG - Intergenic
938269375 2:129955764-129955786 CCGTGGGAAAGAGGCCTTGTTGG + Intergenic
939426203 2:142040065-142040087 CTGGGGAAGAGAGGAAATGTTGG - Intronic
939627773 2:144499194-144499216 CTGGAGTTAAGAGACTTTGTGGG - Intronic
940197196 2:151108040-151108062 TTGGGGATAGGAGGCTTCGTTGG + Intergenic
940849930 2:158678464-158678486 CTGGGGAAGACAGGCCCTGTCGG + Intronic
942493437 2:176512737-176512759 CATGGAAAAAGAGGCTTTGTAGG + Intergenic
943772682 2:191735467-191735489 CTGGAGGAAAGATGCTTTGGAGG + Intergenic
945061944 2:205916892-205916914 CTGGGGGAAAGAGGATGAGTAGG + Intergenic
946765776 2:223038878-223038900 CTGTGGGAATGAGGCTTTGAAGG - Intergenic
948141255 2:235673400-235673422 CTGGGGACAGGTGGGTTTGTAGG + Intronic
948223839 2:236293548-236293570 CTTGGGAGAAGAGGCCTTGCAGG + Intergenic
1169881262 20:10349837-10349859 TTTGGAAAAAGAGTCTTTGTTGG - Intergenic
1171787757 20:29485823-29485845 TTGGGGGAAAATGGCTTTGTTGG - Intergenic
1172223682 20:33290349-33290371 GTGGGGAAAAAAGACTTTCTGGG + Intronic
1173623246 20:44452362-44452384 CTGGGCAAAAGAGGATGAGTTGG - Intronic
1173912257 20:46679090-46679112 ATAGGGAAAAGAGGCTTAATTGG - Intronic
1175477927 20:59290082-59290104 TTGGGGGAAGGAGGCTTCGTTGG + Intergenic
1177068746 21:16474197-16474219 CTCTCCAAAAGAGGCTTTGTGGG + Intergenic
1179154903 21:38841177-38841199 CTCGGCAAAAGAGACTTTGCAGG - Intergenic
1181161867 22:20964423-20964445 CTGGAGCACAGAGGCTGTGTGGG - Intergenic
1182422837 22:30256915-30256937 CTGGGGAAAAGAGAACTTGAGGG + Intergenic
1183604721 22:38861639-38861661 CTGTGGAGAAGACGCTTAGTTGG - Exonic
1183817060 22:40311183-40311205 CTGGGGATAAGTGACATTGTAGG + Intronic
1184049224 22:41991861-41991883 CTGGGGATAGAAGGCTTTCTGGG - Intronic
1185410241 22:50677981-50678003 CTGGGGAAGTGAGGCCTTGTGGG + Intergenic
949131982 3:514425-514447 CTGGGAAAAAAAGGCATAGTAGG + Intergenic
949702481 3:6775237-6775259 TTGGGGAAAAGCGGCTTGGGGGG - Intronic
951108447 3:18772738-18772760 CTGGGGGAAAGAGGAGTGGTGGG - Intergenic
954348117 3:50018151-50018173 GTGGAGAAAAGAGGGTTTCTAGG - Intronic
954789451 3:53120659-53120681 CTTGTGAAAAGGGGCTTTTTTGG - Intronic
956094790 3:65704427-65704449 CTGGGGAAAGGAGGCAATCTAGG - Intronic
957668844 3:83274201-83274223 GTGGGGAAAAGAGGTTTAATTGG + Intergenic
960863891 3:122181260-122181282 GTGGGGAAAAAAGGGTTTATAGG - Intergenic
961439618 3:126945113-126945135 CTGGGGAGAAGAGGCCAGGTAGG + Intronic
968739059 4:2318192-2318214 CTGGGGAAGGGAGCCTTTGGAGG - Intronic
968959638 4:3736647-3736669 CTGGGGAGAAGATGCTTTCTCGG - Intergenic
969459136 4:7318680-7318702 CTGTGGATAAGGGGCTGTGTGGG - Intronic
970107022 4:12596139-12596161 TTGAGGAAAAGAGGCATTCTGGG - Intergenic
971599469 4:28573787-28573809 TAGGGGAAATGAGGCTCTGTGGG - Intergenic
971812419 4:31443669-31443691 CTGTGGAAAAGAGTATTTGAAGG + Intergenic
972706403 4:41548405-41548427 CGGGGGCAAAGAGGCTCTCTTGG - Intronic
975197658 4:71544320-71544342 CCGGGTAGAAGAGGCTATGTTGG + Intronic
978346331 4:107773932-107773954 CTGGGGAAAAAAAGGTATGTGGG + Intergenic
979085033 4:116397372-116397394 CTTTTGAAAAGAGGCTTTCTTGG + Intergenic
979768196 4:124489070-124489092 TGGGGGAAAAGAGACTATGTAGG - Intergenic
979789993 4:124767761-124767783 CTGGGTAACAGAAGCTTTGTAGG + Intergenic
980813180 4:137910276-137910298 GTGGAGAAAAGTGGCTTAGTTGG - Intergenic
981177212 4:141695221-141695243 CTAGGGAGAAGAGGCTTAGAAGG - Intronic
981503142 4:145473669-145473691 CGAGGGAAAAAAGGTTTTGTGGG - Intergenic
982267754 4:153555259-153555281 CTGAGTAAAAGAGACTTTTTGGG - Intronic
983987680 4:174079904-174079926 TTTGGGAAAAGAGTCTTTGCAGG - Intergenic
984830264 4:183966224-183966246 CTGGGGAAGAGAGGAGGTGTGGG + Intronic
984849731 4:184143401-184143423 CTGCAGAGAAGAGGCTTTGCAGG - Intronic
985146854 4:186902540-186902562 CTGGGGATAAAAGGCATTTTAGG + Intergenic
986618944 5:9650330-9650352 CTGGGGAAAAAAGGGTGTGCAGG + Intronic
986747172 5:10754871-10754893 ATGGGGAAAAGTGACTTTGGTGG + Intronic
986911780 5:12566492-12566514 CTGGGTGACAGAGGCTTTCTTGG + Intergenic
987294394 5:16537233-16537255 GTGGAGAAATGAGGCTTTGAGGG + Intronic
989205465 5:38805155-38805177 CTTGGGAAAAGAGCCTTTTTAGG + Intergenic
990159145 5:52917170-52917192 CTGGGGCAGAGAGGATGTGTGGG + Intronic
990796422 5:59546761-59546783 AGGGGAAAAAGAAGCTTTGTGGG - Intronic
991092411 5:62705924-62705946 CTGGGGAAAAGCAGCTCTGAGGG - Intergenic
991265793 5:64715528-64715550 TTGGGGAAAACAGGACTTGTGGG + Intronic
991354726 5:65756324-65756346 CAAGGGAAAGGAGGCTTTTTGGG - Intronic
993776238 5:92001110-92001132 CTGGGGAAGAGAGGGTTGATGGG - Intergenic
994163065 5:96579072-96579094 CAGGGACAAAGAGGCTTTCTGGG + Intronic
994813311 5:104550740-104550762 TTTGGGAAAAAATGCTTTGTGGG + Intergenic
994983678 5:106907700-106907722 CTGGTGAAAATAGGCTTCATTGG + Intergenic
995382626 5:111551592-111551614 CTGGGGAACTAAGGTTTTGTGGG - Intergenic
995508382 5:112883801-112883823 CTGGGTAGAACAGGTTTTGTTGG - Intronic
996024572 5:118630532-118630554 CTGGGAGGAAGAGGCTGTGTTGG - Intergenic
996402747 5:123080896-123080918 CTGGGAAAAAAAGGATTTGATGG - Intergenic
997829789 5:137140013-137140035 CTGGGGAAAAGAGGATATCAGGG + Intronic
997978733 5:138455689-138455711 CTGGAGGAAAGAGGCTTTAAGGG - Intergenic
999724251 5:154421884-154421906 CTGTGGAAAACAGGCCTAGTTGG - Intergenic
1002510268 5:179711440-179711462 CTGTGGAAAAGAAGTTTTTTGGG - Intronic
1004571710 6:16852430-16852452 CAGGGAAAAAGAGACTTTTTAGG + Intergenic
1005072224 6:21872297-21872319 GAGGAGGAAAGAGGCTTTGTAGG - Intergenic
1006317039 6:33297390-33297412 CTGGGGAGAAGGGGCTTTGGGGG - Intronic
1006586523 6:35118304-35118326 CTGGGGAAATGAGGGTTTTTAGG + Exonic
1006937380 6:37727954-37727976 AAGGGGAAAAGAAGCTATGTAGG - Intergenic
1007641917 6:43347891-43347913 CAAGGGAAAAGAGTATTTGTAGG + Intronic
1007703925 6:43780024-43780046 CTGGGGAGGAGAGGCTTGGGCGG - Intronic
1008704117 6:54137347-54137369 CAGGGGAAAAGGGTCTTTGGTGG - Exonic
1012525765 6:100176173-100176195 CATGGGAAAAAATGCTTTGTTGG + Intergenic
1012761249 6:103305277-103305299 CTGGGGAACATAGGGTTTCTGGG - Intergenic
1013178586 6:107698982-107699004 TTGGGGAAAAGAGGTCTTGGGGG - Intergenic
1013869592 6:114741164-114741186 CTGGGGAAAAGTGGATATGAAGG + Intergenic
1014693870 6:124595009-124595031 CAGAGGAAAAGAGGTTGTGTTGG + Intronic
1015489855 6:133812684-133812706 CTAGGGAAAAGAGGTTTCTTTGG + Intergenic
1016071117 6:139740304-139740326 CTGAAGAAAACAGTCTTTGTGGG - Intergenic
1016204401 6:141454181-141454203 CTGGGGTCAAGCGGCATTGTAGG - Intergenic
1017975444 6:159353087-159353109 CTGGGGAGAAGGGACTTTCTGGG - Intergenic
1019042506 6:169118648-169118670 CAGGGGAAGAAAGGCTCTGTGGG - Intergenic
1019644148 7:2120179-2120201 CTGGGGAAGGGAGACTGTGTTGG - Intronic
1020040762 7:4999061-4999083 CTGGGGACAAGCTGCATTGTCGG + Intronic
1020141527 7:5614626-5614648 CTGGAGAAGTGAGGCTTTGAGGG + Intergenic
1020359697 7:7315050-7315072 ATGAGGGAAAGAGGCATTGTGGG + Intergenic
1020726441 7:11820664-11820686 CTGGGGACTAAAGTCTTTGTGGG - Intronic
1020971722 7:14951743-14951765 CTGGGGAGAAGAGGCATTGAGGG + Intronic
1021538963 7:21735739-21735761 GTGGGAAAAACAGTCTTTGTAGG + Exonic
1025611384 7:63078023-63078045 CCTGGGAACAGAGGCTCTGTTGG - Intergenic
1025826731 7:65016800-65016822 CTGGGGAAAAGAGGGGTTCAAGG - Intergenic
1027503078 7:78979598-78979620 CTGTGGGAGAAAGGCTTTGTAGG - Intronic
1028511467 7:91629622-91629644 ATGGGGAAAAGGGCCTTTGCTGG + Intergenic
1030426978 7:109390435-109390457 CACGGGAAAAGAGACTTTATAGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1033601695 7:142893271-142893293 GTGGGGAAAGGAGGGTATGTGGG + Intergenic
1034558516 7:151864817-151864839 CTGGGGACAAGTGGCTTTAAGGG - Intronic
1034725991 7:153335820-153335842 ATGGGGCACAGAGGATTTGTAGG - Intergenic
1035519895 8:267083-267105 CTGGGGAACAGGGGCGGTGTGGG + Intergenic
1035863733 8:3059002-3059024 TTGGGGAAAGGAGGATGTGTTGG + Intronic
1036090357 8:5658250-5658272 CTGGGGCTAAAAAGCTTTGTTGG + Intergenic
1038707063 8:29904026-29904048 CTGGGGGAAAAAGCCTTTGAAGG - Intergenic
1039965544 8:42281157-42281179 CTGGGGAAGGGAGGCTTCTTGGG + Intronic
1040003249 8:42596832-42596854 CTGGGAAAAAGAGGCTAAGTGGG + Intergenic
1040331528 8:46388169-46388191 CTGGGATAAAGAGGCCTTTTGGG - Intergenic
1042873974 8:73424022-73424044 GTGGGGCACAGAGGATTTGTAGG - Intronic
1043479754 8:80641030-80641052 CTAGGTAAAATGGGCTTTGTTGG + Exonic
1043814291 8:84782780-84782802 CTGGGATGAAGATGCTTTGTGGG + Intronic
1044308989 8:90670917-90670939 CTGTTAAAAAGAAGCTTTGTTGG + Intronic
1045427135 8:102078235-102078257 CTGGCGAGAAGGGGCTGTGTAGG - Intronic
1045706995 8:104935614-104935636 GTGGGGAATAGAGGAATTGTGGG + Intronic
1046342109 8:112872770-112872792 CTGGGAAAAATAGGCTAGGTTGG - Intronic
1046971381 8:120227390-120227412 ATGGGGTAAAGAGGGATTGTGGG - Intronic
1047007177 8:120632484-120632506 CTGGGGAAAACAGGCATTGCTGG - Exonic
1047460201 8:125056431-125056453 CAGGGGAAATGAGGCTTAGCTGG - Intronic
1047645224 8:126863058-126863080 TTGTGGAATTGAGGCTTTGTTGG + Intergenic
1047888049 8:129274689-129274711 CTGGGGAAAAGTGGATTAGTGGG + Intergenic
1048242965 8:132762429-132762451 CTTCGGAAAAGTGGATTTGTGGG - Intergenic
1048670324 8:136712155-136712177 CTGGGGAAAGGATGCATTCTTGG + Intergenic
1051868294 9:21707400-21707422 CTGGGGAAAAGATGCTATGCTGG - Intergenic
1055790774 9:79920723-79920745 GTGGGGAATAGATGCTTGGTAGG + Intergenic
1056949305 9:91029293-91029315 TTGAGGAAAAGAGGGTTTGGAGG + Intergenic
1057320238 9:94005999-94006021 CTAGAGAGAAGAGGCTTTTTGGG + Intergenic
1057320438 9:94007661-94007683 CTAGAGAGAAGAGGCTTTTTGGG - Intergenic
1057491209 9:95521321-95521343 CTATGGAATATAGGCTTTGTCGG + Intergenic
1057515505 9:95716890-95716912 CTGGGAAATACAGGCTTTTTAGG + Intergenic
1057726721 9:97573220-97573242 CTGGGGAAGAGCAGCTCTGTGGG - Intronic
1057804979 9:98213297-98213319 CTAAGGAAAAGAAGCTTTGGGGG - Intronic
1059553238 9:115251398-115251420 CTGGGGAAAAGATGCTCTTTGGG + Intronic
1060403544 9:123361764-123361786 CTGGGAAACGGAGGCTCTGTAGG + Intronic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1187216305 X:17280427-17280449 CTGGTGAACAAAGGTTTTGTGGG - Intergenic
1187945929 X:24426553-24426575 GTGGGGGAAAGAGGCATGGTAGG + Intergenic
1190405872 X:50086998-50087020 TGGGGTAAAAGAGGCTTTGGGGG - Intronic
1190703409 X:53005304-53005326 CTGGGGAAAAGAGGTTTAATTGG + Intergenic
1191025672 X:55910286-55910308 CTGGGGAAAATATGCCTTCTTGG + Intergenic
1194082587 X:89486883-89486905 TAGGGGAAAAATGGCTTTGTGGG - Intergenic
1195673933 X:107492457-107492479 ATGGGGAAAAAAGGGTTTCTGGG + Intergenic
1196498531 X:116350795-116350817 ATGGGGAAAAATGGTTTTGTGGG + Intergenic
1196864181 X:120055868-120055890 CAGAGGAAAAGTGGCTTTCTTGG + Intergenic
1196878918 X:120180462-120180484 CAGAGGAAAAGTGGCTTTCTTGG - Intergenic
1197863173 X:130991625-130991647 TTGCGGTAAAGAGGATTTGTTGG + Intergenic
1199584450 X:149398925-149398947 CTGGGGAAGTGAGGCCTTGCTGG - Intergenic
1200435235 Y:3142764-3142786 TAGGGGAAAAATGGCTTTGTGGG - Intergenic
1202599832 Y:26581936-26581958 CTGGGGAAAAGAAACTTTAATGG - Intergenic