ID: 1166214465

View in Genome Browser
Species Human (GRCh38)
Location 19:41326157-41326179
Sequence GCCGCAGACACAGCCTGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166214459_1166214465 7 Left 1166214459 19:41326127-41326149 CCAGCGTGGCACCAGCCGGCAAG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1166214465 19:41326157-41326179 GCCGCAGACACAGCCTGCGCTGG 0: 1
1: 0
2: 2
3: 11
4: 175
1166214463_1166214465 -4 Left 1166214463 19:41326138-41326160 CCAGCCGGCAAGGGGACGCGCCG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1166214465 19:41326157-41326179 GCCGCAGACACAGCCTGCGCTGG 0: 1
1: 0
2: 2
3: 11
4: 175
1166214456_1166214465 18 Left 1166214456 19:41326116-41326138 CCAGCTCCGAGCCAGCGTGGCAC 0: 1
1: 0
2: 2
3: 9
4: 103
Right 1166214465 19:41326157-41326179 GCCGCAGACACAGCCTGCGCTGG 0: 1
1: 0
2: 2
3: 11
4: 175
1166214454_1166214465 24 Left 1166214454 19:41326110-41326132 CCACAGCCAGCTCCGAGCCAGCG 0: 1
1: 0
2: 1
3: 23
4: 240
Right 1166214465 19:41326157-41326179 GCCGCAGACACAGCCTGCGCTGG 0: 1
1: 0
2: 2
3: 11
4: 175
1166214457_1166214465 12 Left 1166214457 19:41326122-41326144 CCGAGCCAGCGTGGCACCAGCCG 0: 1
1: 0
2: 0
3: 17
4: 104
Right 1166214465 19:41326157-41326179 GCCGCAGACACAGCCTGCGCTGG 0: 1
1: 0
2: 2
3: 11
4: 175
1166214464_1166214465 -8 Left 1166214464 19:41326142-41326164 CCGGCAAGGGGACGCGCCGCAGA No data
Right 1166214465 19:41326157-41326179 GCCGCAGACACAGCCTGCGCTGG 0: 1
1: 0
2: 2
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166214465 Original CRISPR GCCGCAGACACAGCCTGCGC TGG Intronic
900031819 1:378160-378182 GCCCCTGACTCAGCCTCCGCAGG + Intergenic
900052367 1:606351-606373 GCCCCTGACTCAGCCTCCGCAGG + Intergenic
900470760 1:2853853-2853875 GCTGCAGACATAGCCTGTGTAGG + Intergenic
900577919 1:3393568-3393590 TCTGCGGACCCAGCCTGCGCCGG - Intronic
900672711 1:3865753-3865775 GCAGAAGACACATCCTGCCCCGG - Intronic
904467835 1:30718620-30718642 GGCGCAGACGGAGCCAGCGCCGG - Intronic
909076322 1:71054109-71054131 GCCGCAGACACATCAGGCTCCGG - Intergenic
910771486 1:90836142-90836164 GCCGCAGACAGTGCCCGTGCCGG - Intergenic
912784713 1:112589875-112589897 GCCCCACACACAGCCAGAGCTGG - Intronic
915096389 1:153465598-153465620 GCCGCATACACAGACAGTGCTGG + Intergenic
918282959 1:183023576-183023598 GCCGCCGCCACCGCCCGCGCCGG + Exonic
919791267 1:201292404-201292426 GTGGCAGACACAGCTTGCCCTGG - Intronic
920218256 1:204377107-204377129 GCCCCAGACTCAGCGTGCCCAGG - Intronic
922728930 1:227940119-227940141 GCTGCAGACACAGACAGGGCAGG - Intronic
1062858019 10:789222-789244 GCCCCCGCCACAGGCTGCGCAGG + Intergenic
1063158943 10:3405416-3405438 GCCGCAGAGTGAGCCTGCTCAGG - Intergenic
1063453041 10:6164027-6164049 GCCGCAGCCACACCCAACGCCGG - Intronic
1065559346 10:26946428-26946450 GCCCCAGGCAGGGCCTGCGCAGG - Intergenic
1066296510 10:34058576-34058598 GCCGCAGACAAAGCCATCCCGGG - Intergenic
1069827290 10:71262079-71262101 ACCGCAGCCCCAGCCTGAGCTGG + Intronic
1072503636 10:96043542-96043564 TCCGCATACAAAGCCAGCGCGGG - Intronic
1076029890 10:127148280-127148302 GAAGCAGACACAGCGTGCTCCGG + Intronic
1076603755 10:131676279-131676301 GGCTGAGACACAGCCTGGGCTGG - Intergenic
1076827284 10:132975383-132975405 CGAGGAGACACAGCCTGCGCCGG - Intergenic
1077074621 11:694758-694780 GCCGCTGCCGCAGCCTTCGCAGG - Exonic
1077490730 11:2859746-2859768 GCAGCTGCCACAGCATGCGCCGG - Intergenic
1077877240 11:6319264-6319286 GCCGGAAGCCCAGCCTGCGCTGG - Exonic
1077899742 11:6478782-6478804 GCTGCAGACCCAGCATGCACTGG - Exonic
1079125301 11:17714464-17714486 GCCACAGGCCCAGCCTGGGCAGG + Intergenic
1081638266 11:44735180-44735202 GCCACAGTCACAGCCTTCCCTGG - Intronic
1083662005 11:64255771-64255793 GCCGCAGACACAGCTTGTTCAGG - Exonic
1083752130 11:64766611-64766633 GCCGCTCACTCAGCCTGCGAGGG + Intronic
1083859635 11:65412948-65412970 GCAGCAGGGACAGCCTGCGCTGG - Exonic
1083952808 11:65966212-65966234 GGCGCAGGCACGGCCTGGGCAGG + Exonic
1089189474 11:116643737-116643759 GCCTCAGCCTCTGCCTGCGCAGG + Intergenic
1091771658 12:3156136-3156158 GCCGCTGACACAGGCTGGGGAGG - Intronic
1096211254 12:49767623-49767645 GCAGGAGACACAGCCTGGTCTGG + Intergenic
1096354990 12:50933485-50933507 GCCTCAGGCACAGCCTGAACAGG + Intergenic
1096870882 12:54591333-54591355 GCTGCAGTCACAGCCTGGGCTGG + Intergenic
1103537299 12:121641712-121641734 GCCTCACGGACAGCCTGCGCAGG + Exonic
1104245620 12:127038321-127038343 GCAGCAGACACAGCTTGGGGAGG - Intergenic
1104697108 12:130872039-130872061 GCCGGAGACGCAGCCGACGCCGG - Exonic
1104878561 12:132053522-132053544 GACCCAGCCACAGCCTGTGCAGG + Exonic
1106340076 13:28819709-28819731 GACCCAGACCCAGCCTCCGCAGG - Intergenic
1109458529 13:62625411-62625433 GGCGCACACAGAGCCTGCTCGGG - Intergenic
1113737722 13:112690224-112690246 GCCGCGGACCCAGCATTCGCCGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119743310 14:77027819-77027841 GCCGCGGAGACAGCCCGGGCGGG - Exonic
1119821038 14:77616452-77616474 GCCGCAGCCGCAGCCGCCGCCGG - Exonic
1121252971 14:92513548-92513570 GCCCCAGCCACAGCCTGTGGAGG + Intergenic
1121640258 14:95480546-95480568 GCTGGAGACACAGCCTCCCCAGG + Intergenic
1122352384 14:101103591-101103613 GCCCCACACACAGCCTGAGCTGG - Intergenic
1122788378 14:104174276-104174298 CCCGCATCCACCGCCTGCGCAGG + Exonic
1122836038 14:104431598-104431620 GCAGCAGACGCAGCCTGAGGTGG - Intergenic
1124469279 15:29968809-29968831 GCCGCAGACACAGCCCCTCCAGG + Intronic
1124612826 15:31220241-31220263 TCCACAGACACAGGCTGAGCGGG - Intergenic
1125195968 15:37046191-37046213 GCAGCAGCCACAGTCTGGGCTGG - Intronic
1128452300 15:67812560-67812582 GCCCCTGAGACAGCCTGGGCTGG + Intergenic
1131065390 15:89431710-89431732 CCTGGAGACACAGCCTGCACCGG + Intergenic
1131123135 15:89835603-89835625 ACAGCAGACACAGCCCGCGCAGG + Exonic
1132467226 16:82946-82968 GCGGCTGACACACCCTGAGCTGG + Intronic
1136628946 16:31478011-31478033 GCCGGGGACAGAGCCAGCGCGGG - Intergenic
1139302532 16:65957699-65957721 GCCCATGACACAGCCTGAGCAGG + Intergenic
1140244075 16:73232416-73232438 GCCGCAGACCCAGCAAGAGCTGG - Intergenic
1141660279 16:85437623-85437645 GCTGGAGCCTCAGCCTGCGCAGG + Intergenic
1141669733 16:85485482-85485504 GCCACAGGCAGAGCCTGAGCAGG - Intergenic
1144021186 17:11241129-11241151 GCCGCAGTCACCGCCGGCGGGGG + Intergenic
1144021349 17:11241651-11241673 GCCGCCGCCACAGCCGCCGCGGG - Exonic
1146163747 17:30573038-30573060 GCCTCACACACACCCTGAGCTGG + Intergenic
1147702354 17:42404099-42404121 TCTGCAGATACAGCCTGTGCTGG + Exonic
1148262218 17:46193486-46193508 GCCGCAGCCGCAGCCGGCGGAGG - Intronic
1151674120 17:75589185-75589207 GCCGCCGCCGCAGCCAGCGCAGG - Intergenic
1151766720 17:76136841-76136863 GCCCCATCCACAGCCTGCCCCGG + Exonic
1152278112 17:79369751-79369773 GCTGCAGAGAGAGCCTGAGCTGG - Intronic
1152357391 17:79813707-79813729 GCCGCAGACAAAGCCCGCCCCGG + Intergenic
1152863645 17:82709795-82709817 GCCCGAGCCACAGCCTGCCCAGG - Intergenic
1152947838 17:83207554-83207576 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1160845135 19:1162949-1162971 GCCCCAGGGACAGCCTGTGCTGG + Intronic
1161466215 19:4432075-4432097 GCGGCTGACAGAGACTGCGCAGG + Exonic
1161574093 19:5046339-5046361 GCCCCAGGCACAGGCTGAGCTGG - Intronic
1161697664 19:5778599-5778621 GCCTCAGCCACAGCCAGGGCAGG + Exonic
1162954324 19:14090033-14090055 GCCGCAGCCACAGCCGCCGCCGG - Exonic
1163582218 19:18145665-18145687 ACAGCAGACCCAGCCTGGGCTGG + Intronic
1163690829 19:18737288-18737310 GCTCCTGATACAGCCTGCGCCGG - Intronic
1165058711 19:33194695-33194717 GCCGCAGCCAGAGCCAGAGCCGG + Exonic
1165140616 19:33697866-33697888 GCTGAAGACACAGCCGGCCCTGG + Intronic
1165633062 19:37317899-37317921 TCTGCAGACCCAGCCTGTGCCGG - Intronic
1166214465 19:41326157-41326179 GCCGCAGACACAGCCTGCGCTGG + Intronic
1166311810 19:41967259-41967281 TCCGCAAACTCATCCTGCGCAGG - Exonic
1166706080 19:44908770-44908792 GCCGCTTACGCAGCTTGCGCAGG - Exonic
1167074774 19:47241322-47241344 GGGGGAGGCACAGCCTGCGCTGG + Intergenic
1167560719 19:50225501-50225523 GCTGGAGACACAGCCCGAGCTGG + Intronic
1167590412 19:50401780-50401802 CCCCCAGGCACAGGCTGCGCTGG - Exonic
1168297245 19:55383537-55383559 ACCGCAGACACAGCAAGCACAGG - Intronic
1168315324 19:55482445-55482467 TCCGCAGCCTCAGCCTGCGGGGG - Exonic
1168315433 19:55482887-55482909 GCCGCAGACACCGCAGGCGTGGG - Exonic
925068002 2:944087-944109 GCCCCAGACTCAGCCAGAGCAGG - Intergenic
925287753 2:2727048-2727070 GCAGCAGAACCAGCCTGTGCTGG + Intergenic
926008978 2:9393624-9393646 CCCGCAGAAGAAGCCTGCGCCGG + Exonic
926939484 2:18119636-18119658 GCAGAAGACACAGCCCGTGCAGG - Intronic
930018930 2:46989257-46989279 GGCCCAGAAACAGCCTGCGTGGG - Intronic
944589539 2:201204060-201204082 GCAGCAGAAACAGCCCCCGCAGG + Intronic
946420363 2:219561305-219561327 GCCCCAGACACACACTGGGCTGG + Intronic
946869320 2:224071678-224071700 GCAGCAGCCACAGCCTGAGAAGG - Intergenic
948643783 2:239391377-239391399 GCTGCAGAGACACCCTGAGCAGG + Intronic
948750692 2:240130986-240131008 GCCGCAGTGTGAGCCTGCGCAGG - Intronic
948856105 2:240731429-240731451 GCCGCTGACACAGCCAGAGCTGG + Intronic
1172801014 20:37576230-37576252 GCCCCAGACACAGCCAGCTGGGG - Intergenic
1175160664 20:57005376-57005398 ACCACACACACAGCCTGAGCAGG + Intergenic
1175781803 20:61687456-61687478 TCCTCAGCCACAGCCTGGGCGGG + Intronic
1175916752 20:62429573-62429595 GCCACAGGCACAACCTGCACGGG - Intergenic
1175973741 20:62699879-62699901 GCCACGGACACAGCCAGGGCCGG - Intergenic
1176310836 21:5148037-5148059 GCCACAGACACAGCCTGCGGCGG + Intronic
1179375688 21:40848211-40848233 GCCGCCCACTCAGGCTGCGCAGG + Intergenic
1179846219 21:44113998-44114020 GCCACAGACACAGCCTGCGGCGG - Intronic
1180920302 22:19518260-19518282 GCCCCAGACCCAGCCCACGCAGG - Intronic
1181787264 22:25236193-25236215 GCCGCTGACAGTGCCTGGGCAGG + Intergenic
1182547890 22:31086092-31086114 GCCTGAGACACAGCCAGCACCGG + Intronic
1184687392 22:46102787-46102809 CCCACAGCCACAGCCAGCGCAGG - Intronic
1185061885 22:48611431-48611453 GCAGCAGACACAGCCACCCCTGG + Intronic
1185176980 22:49333475-49333497 GCTGGAGACACAGGCTGCGATGG + Intergenic
949282143 3:2358891-2358913 CCTGCATACACAGCCTGCACCGG - Intronic
954361706 3:50125737-50125759 GCCTGAGGCACAGCCTGGGCGGG - Intergenic
954437356 3:50503282-50503304 GCAGCAGCCACAGCGGGCGCGGG + Exonic
954830562 3:53417858-53417880 GCCGCAGCCATAGCCTGAGAAGG - Intergenic
954840766 3:53509421-53509443 GCCCCAGACACTGCCTGGGCTGG + Intronic
956103356 3:65791216-65791238 GGTGCAGACCCAGCCTGCGTGGG + Intronic
961166177 3:124765425-124765447 GCTCCACACACAGCCTGGGCGGG - Intronic
966392166 3:179464334-179464356 GTCGCAGCCATAGCCTGTGCCGG - Intergenic
968889598 4:3361454-3361476 GACGCTAACACAGCCTGCTCCGG - Intronic
969291677 4:6244143-6244165 GACACAGACACAGACTGAGCTGG - Intergenic
969439171 4:7207339-7207361 CCCGCCCACACAGCCTGGGCCGG + Intronic
969613486 4:8239713-8239735 GCCCCAGACTCAGCCTGGGGTGG - Intronic
969670075 4:8585301-8585323 GCTCCAGACACAGCCTCAGCTGG + Intronic
970157188 4:13153229-13153251 GCCGCAGACAATGCCAGCCCAGG - Intergenic
978761492 4:112359048-112359070 GCAGCGGACACAGCCAGCCCTGG + Intronic
979197877 4:117941792-117941814 GAGGCAGCCACAGCCTGTGCTGG + Intergenic
981831225 4:149004538-149004560 GCAGGAGACACAGCCTCAGCAGG + Intergenic
985547385 5:516517-516539 GATGCAGACACACCCTGGGCAGG - Intronic
989484133 5:41968355-41968377 GTCGCAGCCATAGCCCGCGCCGG + Intergenic
991175743 5:63685903-63685925 GCCGGTGACACAGCCTCAGCAGG - Intergenic
991548200 5:67806897-67806919 GACACAGACACAGCATGTGCTGG + Intergenic
997233066 5:132257701-132257723 GCCGCAGCCGGAGCCTGAGCCGG - Exonic
997595169 5:135102558-135102580 GCTGCAGGCACACCCTGAGCAGG - Intronic
998510919 5:142713341-142713363 GCCCCTTACACAGCCTGCGAGGG + Intergenic
999439947 5:151593335-151593357 GCTGCAGACAGTCCCTGCGCTGG - Intergenic
999592255 5:153160874-153160896 TCCGCACAAACAGCCTGCACTGG - Intergenic
1002742001 5:181440708-181440730 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1005667768 6:28075892-28075914 GCCACTGACACTGCCTGCCCTGG + Intergenic
1013210918 6:107986021-107986043 GTCGCAGCCATAGCCCGCGCCGG + Intergenic
1014778803 6:125540118-125540140 GCAGCACACACAGCCTCTGCTGG + Intergenic
1016906143 6:149152567-149152589 GCAGCAGCCACAGCCTAAGCAGG + Intergenic
1018043545 6:159946069-159946091 GCAGCAGCCACAGCCTGAGAAGG - Intergenic
1019150132 6:170000069-170000091 GCCTGAGACACAGCCTGAGGAGG - Intergenic
1019247138 6:170716446-170716468 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1023435226 7:40134911-40134933 GCCGCAGACCCCGCCCCCGCCGG - Intergenic
1024530728 7:50390263-50390285 GCCACACCCACAGCCTGCCCAGG - Intronic
1025190668 7:56893317-56893339 GCCCCAGCCAGAGCCTGCTCTGG - Intergenic
1025681275 7:63683607-63683629 GCCCCAGCCAGAGCCTGCTCTGG + Intergenic
1028650654 7:93147052-93147074 TCCACAGACACAGTCTGCTCGGG + Exonic
1028712205 7:93922010-93922032 GCTGCAGTCACATCCTGCGCGGG + Exonic
1032195307 7:129785166-129785188 ACCGCAGACACAATCTGCGAGGG - Intergenic
1033007200 7:137579220-137579242 GCCGCAGACAGTGCCTGTGTTGG + Intronic
1034172353 7:149072003-149072025 GCAGCAGACACAGCTTCCGGCGG + Exonic
1035500999 8:91488-91510 GCCCCTGACTCAGCCTCCGCAGG + Intergenic
1036634376 8:10538848-10538870 GCTGCAGACAGAGCCTCTGCTGG - Intronic
1039845013 8:41319975-41319997 GCTGCTGACACAGCCTTGGCCGG + Intergenic
1043395029 8:79827635-79827657 GCAGCACACACAGCCTGCAGAGG - Intergenic
1043847275 8:85177486-85177508 GCCGCCGCCGCAGCCTCCGCAGG + Exonic
1044934149 8:97277474-97277496 GCCGCAGACACTGTCTTCGTGGG - Exonic
1045518991 8:102886909-102886931 GCCACTCACACAGCCTGAGCAGG + Intronic
1048978726 8:139691247-139691269 ACCCCAGACACAGCCAGTGCAGG - Intronic
1049071186 8:140357320-140357342 GCAGCAGACACAGCAGGCGAAGG + Intronic
1049392206 8:142377669-142377691 GCCTCAGACACAGCTTGTGGGGG + Intronic
1053137588 9:35661114-35661136 GCCCCAGTCACAGCCTTGGCTGG + Exonic
1056078159 9:83062584-83062606 GCCTCAGACACGGCGGGCGCGGG + Exonic
1057208022 9:93184798-93184820 GCCGCGGAGAGAGCCTGCGGGGG - Intergenic
1060514582 9:124257940-124257962 GCCGCCGCCACCGCCTGCGCGGG - Intronic
1062240276 9:135533931-135533953 GCCGCAGACACACCCTCTCCAGG + Intergenic
1062376928 9:136266104-136266126 GTCACAGACACAGCCAGCCCTGG + Intergenic
1203607913 Un_KI270748v1:71924-71946 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1185867400 X:3636254-3636276 GGTGCAGACACAGGCTGCGAAGG + Intronic
1187226039 X:17375967-17375989 GCCGCCGCCACTGCCCGCGCCGG + Exonic
1188037771 X:25338045-25338067 GCCGCAGCCACATCCGGTGCTGG + Intergenic
1191846079 X:65549290-65549312 GCAGCAGGGACAACCTGCGCTGG + Intergenic
1192533765 X:71911275-71911297 GCCGCACAGACAGCCTGTACCGG + Intergenic
1194177459 X:90667750-90667772 GCCGCAAAGAGAGCTTGCGCAGG - Intergenic
1198387054 X:136139002-136139024 GCCTCAGACACAGCTTTCTCAGG - Intergenic
1200524132 Y:4249896-4249918 GCCGCAAAGAGAGCTTGCGCAGG - Intergenic