ID: 1166214471

View in Genome Browser
Species Human (GRCh38)
Location 19:41326174-41326196
Sequence CGCTGGGTATGGAGGCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166214459_1166214471 24 Left 1166214459 19:41326127-41326149 CCAGCGTGGCACCAGCCGGCAAG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG 0: 1
1: 0
2: 1
3: 5
4: 89
1166214464_1166214471 9 Left 1166214464 19:41326142-41326164 CCGGCAAGGGGACGCGCCGCAGA No data
Right 1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG 0: 1
1: 0
2: 1
3: 5
4: 89
1166214463_1166214471 13 Left 1166214463 19:41326138-41326160 CCAGCCGGCAAGGGGACGCGCCG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG 0: 1
1: 0
2: 1
3: 5
4: 89
1166214457_1166214471 29 Left 1166214457 19:41326122-41326144 CCGAGCCAGCGTGGCACCAGCCG 0: 1
1: 0
2: 0
3: 17
4: 104
Right 1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG 0: 1
1: 0
2: 1
3: 5
4: 89
1166214466_1166214471 -7 Left 1166214466 19:41326158-41326180 CCGCAGACACAGCCTGCGCTGGG 0: 1
1: 0
2: 4
3: 25
4: 260
Right 1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG 0: 1
1: 0
2: 1
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166214471 Original CRISPR CGCTGGGTATGGAGGCCAAC AGG Intronic
901781577 1:11598072-11598094 GGCTGGGCATGGAGGCCTCCAGG + Intergenic
903372638 1:22846824-22846846 CGCTGGGTCTGGAAGCCCAGAGG - Intronic
905044212 1:34983750-34983772 TGATGGGTAAGGGGGCCAACTGG - Exonic
907973055 1:59403585-59403607 AGGTGGGTATGGGGGCCACCTGG + Intronic
908817575 1:68050047-68050069 CGCTGGGTTTGGACGCCCTCTGG - Intronic
917429495 1:174951294-174951316 GGCAGGCTCTGGAGGCCAACTGG + Intronic
919987920 1:202688855-202688877 GGCTGGGTGAGGAGGCCACCCGG - Intronic
921441015 1:215186136-215186158 GGCTGGGTATGGTGGCAAAATGG + Intronic
922238232 1:223737280-223737302 GGCTGGGTATGGAGGCAGCCTGG + Intronic
923506116 1:234608466-234608488 TGTTGGGTTTCGAGGCCAACGGG - Exonic
1066174733 10:32891673-32891695 AGCTGGGTCTGGAGGGTAACAGG + Intergenic
1069785474 10:70985155-70985177 CGCTGGGAATGAAGCCCAGCAGG - Intergenic
1079848781 11:25502794-25502816 CAGTGGATATGGAGGCCTACTGG - Intergenic
1080543732 11:33295354-33295376 CCCTGGCTAGGGAGACCAACAGG - Intronic
1082698791 11:56402250-56402272 CGCTGGGCTTGGGGGCCAACTGG - Intergenic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1096332412 12:50725806-50725828 GGCTGGGAATGGAGCCAAACTGG - Intronic
1101966488 12:109285668-109285690 TGCTGGGGACTGAGGCCAACTGG + Intronic
1108741695 13:53345415-53345437 AGCTGGATATGGAGGGTAACAGG - Intergenic
1110080255 13:71300431-71300453 GTCTGGGTGTGGAGGGCAACTGG + Intergenic
1118498127 14:66329078-66329100 CTCTGGCTGTGGAAGCCAACTGG - Intergenic
1127078365 15:55350456-55350478 TGATGGTTATGGAGTCCAACAGG - Intronic
1132701117 16:1222538-1222560 GGCTGGGTGTGGAAGCCACCAGG + Intronic
1132867384 16:2100197-2100219 CGGTGGAGACGGAGGCCAACGGG - Exonic
1133915395 16:10105064-10105086 CTCTGGGTCTGGAGCCGAACTGG + Intronic
1134524393 16:14932918-14932940 CGGTGGAGACGGAGGCCAACGGG + Intronic
1134548508 16:15128023-15128045 CGGTGGAGACGGAGGCCAACGGG - Intronic
1134711981 16:16331405-16331427 CGGTGGAGACGGAGGCCAACGGG + Intergenic
1134719839 16:16374698-16374720 CGGTGGAGACGGAGGCCAACGGG + Intergenic
1134947587 16:18337187-18337209 CGGTGGAGACGGAGGCCAACGGG - Intergenic
1134954847 16:18377289-18377311 CGGTGGAGACGGAGGCCAACGGG - Intergenic
1135759562 16:25126267-25126289 CGCAGGGTCTGGAGGGCATCTGG - Intronic
1136244388 16:28965311-28965333 GGCTGGGTATGGAGGTTCACTGG + Exonic
1136551968 16:30986676-30986698 GGCTGGTCCTGGAGGCCAACGGG + Exonic
1139809990 16:69606573-69606595 GGCTGGGTATGGTGGCTCACGGG + Intronic
1141664425 16:85458536-85458558 AGCTGGGCATGGAGGCCCAGGGG + Intergenic
1141832634 16:86518222-86518244 CCCTGTGGATGGAGGCAAACGGG - Intergenic
1141939468 16:87265260-87265282 TGCTGGGTTTAGAGGCCAATAGG - Intronic
1141964777 16:87434462-87434484 CGCTGGGTCTGGAGGCCACCTGG + Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1144776234 17:17786151-17786173 AGGTGGGTATGGAGACAAACTGG - Intronic
1145724625 17:27107137-27107159 CCCTGGATATGCAGCCCAACAGG + Intergenic
1146362110 17:32185549-32185571 AGCTGGGTATGGTGGCACACAGG - Intronic
1146891906 17:36511762-36511784 GGGTGGGCATGGAGGCCCACAGG - Intronic
1150229486 17:63542264-63542286 GGCTGGGCATGGAGGCTGACGGG - Exonic
1151134903 17:71937149-71937171 CGCTGGGAATGCAGCCCAACAGG + Intergenic
1151384947 17:73749162-73749184 CGTTGGGAATGAAGGCCAAGGGG - Intergenic
1151791075 17:76306404-76306426 AGCTGGGTGGGGAGGCCAAGAGG - Intronic
1151907106 17:77056013-77056035 CGCTGGGAATGGAGGCCTGTGGG - Intergenic
1152713241 17:81885464-81885486 GGCTGGGTCTGGAAGCCACCGGG - Intergenic
1156489736 18:37489109-37489131 GGCTGGATATAGAGGCTAACTGG + Intronic
1160698499 19:495716-495738 CGCTGGGGATGGAGGCCCCCTGG - Intronic
1164983036 19:32628368-32628390 TGCTGGGTGTGGAGGCCTAAAGG - Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG + Intronic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
932433858 2:71691724-71691746 CCCTGGGGGTGGAGGCAAACTGG - Intergenic
934963949 2:98703641-98703663 CACTGGATATGGAGGCCACAGGG - Intronic
937364208 2:121249086-121249108 CTCTGGGGAGGGAGGCCAGCAGG + Exonic
938106070 2:128530591-128530613 CACTTGGAATGGTGGCCAACGGG - Intergenic
948588107 2:239033964-239033986 GGCTGGGGCTGGAGGCCACCTGG + Intergenic
1173664982 20:44757036-44757058 CGCTGGGGATAGAGGCCAGCAGG + Exonic
1178459527 21:32790085-32790107 TGCTGGGAATGCAGGCCAGCAGG + Intergenic
1179893462 21:44349412-44349434 CCCTGGACATGGAGGCCAGCAGG + Intergenic
1180009922 21:45042844-45042866 CTCTGGGTGTGGAGACAAACGGG + Intergenic
1183588095 22:38764637-38764659 CGCTGGGTATCGGGGCCACAGGG + Intronic
949759375 3:7452422-7452444 AGCTGGATATGGATACCAACTGG + Intronic
949837037 3:8280426-8280448 CACTGGGGATGGAGGCACACAGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
959010404 3:101069387-101069409 CCTTGGTTTTGGAGGCCAACAGG - Intergenic
962267671 3:133955244-133955266 GGCCGGGTTTGGAGGCCAGCCGG - Intronic
967974479 3:195025324-195025346 GGCTGGGTGTGAAGGCAAACTGG - Intergenic
968902625 4:3438670-3438692 CCCTGGGTAGGGAGGCCTCCCGG + Intronic
985902401 5:2806670-2806692 AGCTGGCTCTGGAGGCCCACAGG + Intergenic
986296828 5:6446350-6446372 CGCTGGGTGTGGACCCCAGCTGG + Intergenic
1017635211 6:156436579-156436601 CACTGGGCAAGGAGGCCATCTGG - Intergenic
1018203136 6:161413468-161413490 AGCTGGGAATGGAAGCCAAGTGG + Intronic
1019540887 7:1550524-1550546 CGCTGGGGATGGGGTCCATCAGG - Intronic
1022802248 7:33787756-33787778 AGCTGGGTTTGGAGCCCAAGAGG - Intergenic
1025035285 7:55589798-55589820 TGCAGGGTAAGGGGGCCAACTGG - Intergenic
1026477682 7:70750725-70750747 GGCTGGGTATGCATGCCAAGAGG - Intronic
1026658151 7:72275401-72275423 CGCAGGGTCTGGAAACCAACTGG - Intronic
1029728887 7:102426325-102426347 CTCGGGGTTTTGAGGCCAACAGG + Exonic
1034174603 7:149090761-149090783 CGCTGCGTTTGGGGGCCACCCGG - Intronic
1034224609 7:149473119-149473141 GGCTGGGTTTGGGGGCCAAGTGG - Exonic
1035040151 7:155921198-155921220 AGCTGGGTTTGGAAACCAACGGG - Intergenic
1049360853 8:142212000-142212022 GGATGGGAATGGAGGCCAACAGG - Intergenic
1049447528 8:142638256-142638278 CGCTGGTAATGGAGGCCTCCTGG - Intergenic
1050529405 9:6575246-6575268 CGCTGGGGATGGAGCCCATATGG - Intronic
1060069503 9:120533924-120533946 AGCTGGGAATGGAGGAGAACAGG - Intronic
1062109800 9:134775888-134775910 CCTGGGGCATGGAGGCCAACTGG + Intronic
1062333386 9:136054322-136054344 CCCTGGGGATCGAGGACAACTGG + Intronic
1185891069 X:3822481-3822503 CTCAGGGTATGGTGGCCAATGGG + Intronic
1185896173 X:3860897-3860919 CTCAGGGTATGGTGGCCAATGGG + Intergenic
1185901292 X:3899323-3899345 CTCAGGGTATGGTGGCCAATGGG + Intergenic
1192757188 X:74058699-74058721 AGCTGGGTATGGAGGGTCACAGG - Intergenic