ID: 1166219133

View in Genome Browser
Species Human (GRCh38)
Location 19:41353903-41353925
Sequence GCGCGAAGGGCGGCGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 13, 3: 64, 4: 439}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166219111_1166219133 29 Left 1166219111 19:41353851-41353873 CCCTCGCTGTCTGGCTGCTCCGC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 64
4: 439
1166219121_1166219133 10 Left 1166219121 19:41353870-41353892 CCGCGGAGGGAGGTGGGAGGGAG 0: 1
1: 1
2: 8
3: 88
4: 803
Right 1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 64
4: 439
1166219112_1166219133 28 Left 1166219112 19:41353852-41353874 CCTCGCTGTCTGGCTGCTCCGCG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 64
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166219133 Original CRISPR GCGCGAAGGGCGGCGGCGGC GGG Exonic
900113895 1:1020580-1020602 GCGAGGAGGGAGGCGGCGGCGGG - Intronic
900349829 1:2229003-2229025 GCAGCACGGGCGGCGGCGGCTGG - Exonic
900366891 1:2315125-2315147 GCGGGAAGCAGGGCGGCGGCAGG + Intergenic
900650577 1:3728146-3728168 GCACCAAGGGCGGGGACGGCAGG - Exonic
900786770 1:4654657-4654679 GCGCGGTGGGCGCGGGCGGCGGG + Intergenic
901086079 1:6613351-6613373 TTGCGAAGGGCGGCGGCGGCTGG - Intronic
901251731 1:7784355-7784377 GGGCCAAGGGCGGGGGCAGCAGG + Intronic
901373245 1:8818012-8818034 GCGCGGCGGGCGGCGGAGGAGGG - Intergenic
902600894 1:17539701-17539723 TCGCGCACGGCGGCGGCGGCGGG + Intergenic
902823237 1:18956231-18956253 GCGGGGGCGGCGGCGGCGGCGGG - Exonic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
903155630 1:21440524-21440546 GGGCTGAGGGCGGCAGCGGCAGG - Intronic
903389362 1:22953405-22953427 GCGCGGTGGGCGGCGGAGCCGGG + Exonic
903738201 1:25543668-25543690 GCGGCAGCGGCGGCGGCGGCCGG + Exonic
903750211 1:25616798-25616820 GCCCGAGCGGCGGCGGCGGCGGG + Intergenic
903925139 1:26826635-26826657 CCGCGGCGGGCGGTGGCGGCGGG + Intergenic
904171039 1:28592420-28592442 GAGCGGGGGGCGGCGCCGGCGGG + Intronic
904542012 1:31239645-31239667 GCGCGCCGGGCGGCGGGGCCGGG + Intergenic
904696956 1:32336202-32336224 GCGCGGAGCGGAGCGGCGGCGGG - Exonic
905463071 1:38134002-38134024 CCGAGGAGGGAGGCGGCGGCCGG + Intergenic
905580765 1:39081590-39081612 GCGGGATGCGCAGCGGCGGCTGG + Intronic
905639144 1:39576580-39576602 ACGCCAAGCGCTGCGGCGGCGGG + Intronic
905869416 1:41394670-41394692 GAGGGAAGGGCGGTAGCGGCCGG - Intergenic
905960058 1:42035809-42035831 GCGCGCCGGGCCGGGGCGGCGGG + Intronic
906027026 1:42682608-42682630 GCGCTGAGGGCGGGGGCGGCGGG - Exonic
906615758 1:47231966-47231988 GCGGGAGGGGCGGCGGCAGCCGG + Intronic
906793432 1:48678228-48678250 GGCAGAAGGGCGGGGGCGGCGGG - Intronic
907188987 1:52633254-52633276 GCGGGGCGGGCGGCGGGGGCCGG - Intergenic
907905673 1:58782513-58782535 GCGCGCTGAGCAGCGGCGGCGGG - Exonic
908544129 1:65147913-65147935 GTGCGTGGGGCGGCGGGGGCTGG + Exonic
910182986 1:84505963-84505985 GGGAGGAAGGCGGCGGCGGCGGG - Intronic
910569688 1:88684978-88685000 GCGCGAAGGGAGGGGGCAACAGG - Intronic
912361682 1:109100657-109100679 ACGTGAACGGCGGCGGCGGGCGG + Intergenic
914803043 1:150974425-150974447 GCGCTCATGGCGGCGGCCGCCGG - Intronic
915463190 1:156081737-156081759 GCGCCGCGGGCGGCGGCGGCGGG + Exonic
916048897 1:161021177-161021199 GCGCGGAGGGCGGGGCCGGGCGG - Exonic
916130224 1:161606101-161606123 GCGGGAAGGTTCGCGGCGGCGGG + Intronic
918265672 1:182839548-182839570 GCGCGGGCGGCGGCGGCGGCTGG + Intronic
919809403 1:201399341-201399363 GCGCCAGGTGAGGCGGCGGCCGG - Exonic
919892040 1:201982705-201982727 GCGCGGAGTGCAGCGGCCGCCGG - Exonic
920071791 1:203307441-203307463 GCGCCCAGGGCGGGGGCGGAAGG - Exonic
920367726 1:205456917-205456939 GCGCGGAGGGCGGGGTGGGCCGG - Intergenic
920394168 1:205631818-205631840 GCGCCAGGAGCCGCGGCGGCGGG - Exonic
921023738 1:211259314-211259336 GCGGGGCGGGCGGCGGCGGAGGG + Intronic
921138773 1:212285847-212285869 GAGGGAAGGGCGGGGGCGGAGGG - Exonic
921217737 1:212951477-212951499 GCGGCAGCGGCGGCGGCGGCGGG - Exonic
921472674 1:215567569-215567591 GCCAGCGGGGCGGCGGCGGCCGG - Exonic
922200078 1:223393862-223393884 GCGGGCAGGGCTGCGGCCGCTGG - Exonic
922249763 1:223837920-223837942 GGGAGAGGGGCGGCGGGGGCGGG - Intronic
923008005 1:230067381-230067403 GCGCGGGCGGCGGCGCCGGCAGG + Exonic
924118467 1:240771578-240771600 GCGCGCAGGGCAGGGGCGGGCGG + Intergenic
1062895005 10:1096692-1096714 GCGCGCAGAGCGGGGGCTGCTGG + Intronic
1064086640 10:12350178-12350200 GCGGAGAGGGCGGCGGTGGCAGG - Intronic
1064418282 10:15168826-15168848 GCGGGCAGGGCGGGGCCGGCGGG - Intergenic
1065186507 10:23174554-23174576 GCGGGCAGGGCGGGGGAGGCCGG + Intergenic
1065589785 10:27252574-27252596 GCGCCCCTGGCGGCGGCGGCGGG - Intergenic
1065712824 10:28533494-28533516 GCGCAGGCGGCGGCGGCGGCGGG - Exonic
1066180469 10:32957553-32957575 GCGCCGCGGGCGGGGGCGGCGGG - Intronic
1066464217 10:35639480-35639502 GGCCGGGGGGCGGCGGCGGCGGG - Exonic
1066464514 10:35640824-35640846 GCGGCAGGGGCGGTGGCGGCGGG - Exonic
1066950403 10:42111620-42111642 GGGCGAAAAGCCGCGGCGGCGGG + Intergenic
1067251282 10:44589076-44589098 GAGAGAAGGGCAGGGGCGGCAGG - Intergenic
1068788401 10:61001589-61001611 CCCCGCAGGGCGGCGGCTGCCGG - Intergenic
1072408991 10:95183569-95183591 TAGCGAGAGGCGGCGGCGGCCGG + Intergenic
1072591515 10:96832413-96832435 GCCGGAGGGGCGGCGGCGGTCGG - Intronic
1072700914 10:97640848-97640870 GTCCGAGTGGCGGCGGCGGCCGG + Exonic
1073207463 10:101776370-101776392 GCGGGAGGGGCGGGGGCGGCCGG + Intronic
1074618589 10:115093818-115093840 GGCCGGCGGGCGGCGGCGGCGGG + Exonic
1074772264 10:116742056-116742078 GCGCGATGGGCTGCGGAGGCCGG - Intronic
1075629376 10:123991872-123991894 GCGGGGCGGGCGGCTGCGGCGGG + Intergenic
1075652757 10:124140003-124140025 GCACGCAGGGCGGCCGAGGCAGG + Intergenic
1075768910 10:124917115-124917137 GCGCGAAGGGAGGCGGAGAGGGG + Intergenic
1076035550 10:127196277-127196299 GCGCGCGGGGAGGCAGCGGCTGG + Intronic
1076373781 10:129970651-129970673 GGGCGATGGGTGCCGGCGGCCGG + Intergenic
1076374057 10:129971899-129971921 GGGGCGAGGGCGGCGGCGGCGGG - Intergenic
1076825338 10:132964450-132964472 GAGCGCAGGGAGGCGGCCGCAGG - Intergenic
1076858425 10:133128470-133128492 GCCCGAGGAGCAGCGGCGGCTGG + Exonic
1077053100 11:576498-576520 GCGGCAGAGGCGGCGGCGGCCGG + Exonic
1077285688 11:1764222-1764244 GCGGGGACGGCCGCGGCGGCCGG - Intergenic
1077491405 11:2862554-2862576 GCGCGAGGAGCGGGCGCGGCCGG - Intergenic
1077492798 11:2869935-2869957 GCGGGAAGCGCGGCCGCGGCCGG + Intergenic
1077714696 11:4569352-4569374 GCGGGGAGGGTGGCGGCGGAAGG + Intergenic
1078771918 11:14359088-14359110 GGGCCAGGGGCGGCAGCGGCCGG + Exonic
1079407166 11:20156989-20157011 GGGTGAAGGGCGGGGGCGGGGGG + Intronic
1083644747 11:64165786-64165808 GCGTGGGGGGCGGCGGCGGTGGG - Exonic
1083656986 11:64234572-64234594 GCGGGGACGGCGGGGGCGGCGGG - Exonic
1084225422 11:67712036-67712058 GTGCGAAGCGAGGCGGCCGCGGG - Intergenic
1084304386 11:68272036-68272058 GGGCGAAGAGCGGCTGCGGCGGG + Intergenic
1084310230 11:68312518-68312540 GCGCGGGTGGCGGCGGCGGGGGG + Intergenic
1085284627 11:75351727-75351749 GCGGGGGCGGCGGCGGCGGCCGG - Intergenic
1085643327 11:78207145-78207167 GTGCGAGGGGCTGCTGCGGCTGG + Intronic
1089216146 11:116835781-116835803 CCGGGAAGGGGGGCGGCGGCGGG + Exonic
1089564556 11:119363937-119363959 GCGGGAAAGGGGGCGGCGGGGGG + Intronic
1090238261 11:125165065-125165087 GCGCGAGGGGCGGCGAGGCCGGG + Intronic
1090636908 11:128695000-128695022 GCGCGAAGGGCGGGGGCTCGGGG - Intronic
1091915434 12:4269514-4269536 GGGAGAAGGGCGGAGGCGGCCGG + Intergenic
1092219124 12:6700760-6700782 GGGCGCGGGGCGGCGGCGGTGGG + Intronic
1092335427 12:7628752-7628774 GCGGCAGGGGCGGCGGCGGCAGG - Intergenic
1095261662 12:40105623-40105645 GCGCGGGCGGCGGCGGCGTCGGG - Exonic
1095581655 12:43806583-43806605 CAGCGAATGGCGGCGTCGGCGGG - Intergenic
1096232479 12:49904052-49904074 GGGCTAAGGGCGGCGGTGGGGGG - Intronic
1096647594 12:53047191-53047213 GCGCGGGGCGCGGCGGGGGCGGG + Intronic
1096784414 12:54009056-54009078 GCGCGGGCGGCGGCGGCGGCGGG - Intronic
1096796781 12:54082635-54082657 GCGGGAGGGGAGGCGGAGGCGGG + Intergenic
1098161056 12:67648681-67648703 CGGCGGAGGGCGGCGGGGGCGGG + Intronic
1098320705 12:69240133-69240155 GGGGAAGGGGCGGCGGCGGCGGG - Intronic
1100632222 12:96400285-96400307 GCGCGGCGGGCGCCGACGGCGGG + Exonic
1101168340 12:102062060-102062082 GCGGGAAGGGCCCCGGAGGCGGG - Exonic
1102197265 12:111034338-111034360 GGGCGGCGGGCGGCGGCTGCCGG + Intronic
1103363993 12:120369284-120369306 GCGCGCAGGGCGGCGGGGGGAGG - Intergenic
1103488201 12:121296750-121296772 GCGCGGGGGGCGGGGGCGGGAGG + Intronic
1103604719 12:122078432-122078454 GCGCGGAGCGGGGCGGGGGCGGG + Intergenic
1103698551 12:122835664-122835686 GGGCGGCGGGCGGCGGCGGGCGG + Intronic
1104444753 12:128823993-128824015 GCGAGAAGGGCGGCGGCCCTGGG - Intergenic
1104983384 12:132583611-132583633 GCGCCGAGGGCGGCGGCGGCGGG - Exonic
1106516975 13:30464815-30464837 GCGGGCGCGGCGGCGGCGGCGGG + Intronic
1110119372 13:71864817-71864839 GCGCGCACGGAGGAGGCGGCGGG - Intronic
1110219551 13:73059039-73059061 TCGCGGAGGTCGGCGGTGGCGGG + Exonic
1110573065 13:77026937-77026959 GCGCGGGGGGCCGCGGCTGCGGG - Exonic
1112733689 13:102394687-102394709 GAGCAGAGGGCAGCGGCGGCGGG + Intronic
1113201065 13:107867593-107867615 GCGCGGGGGCGGGCGGCGGCGGG + Intergenic
1113312011 13:109140912-109140934 GCCAGAAGGGCGACGGCGACAGG + Exonic
1113655927 13:112067762-112067784 GCGGGGGCGGCGGCGGCGGCGGG + Exonic
1115028326 14:28767206-28767228 GCGCGGCGGGCGGCGGCGACCGG - Exonic
1115028384 14:28767447-28767469 GCGGGGCGGGCGGCGGCGGGTGG - Exonic
1115474487 14:33800385-33800407 CCCCGCAGGGCGGCGGCGGTGGG + Exonic
1115474557 14:33800586-33800608 CCGGGAACGGCGGCGGGGGCGGG + Exonic
1117424459 14:55580375-55580397 CCGGGACGGGCGCCGGCGGCGGG + Intronic
1117647106 14:57865010-57865032 CCGCGACGTGCGGCGGGGGCGGG + Intronic
1117978627 14:61321445-61321467 GCGCGCAGGGCGGCGCAAGCGGG + Intronic
1118030473 14:61813068-61813090 CCGCGAAGGGCTGCGATGGCAGG - Intergenic
1118350968 14:64972248-64972270 CCGGGAAGCGCGGCTGCGGCGGG + Intronic
1118463907 14:66013737-66013759 GCGCTGAGGGCGGGGGCGGCGGG + Intergenic
1119410282 14:74426091-74426113 GCGGGGCGGGCGGCGGCGGCGGG - Exonic
1119456847 14:74763546-74763568 GCGCCACTGGCGGCGGCGGTGGG - Exonic
1121050488 14:90816443-90816465 GGGAGGCGGGCGGCGGCGGCGGG + Intronic
1121183578 14:91947706-91947728 GCGCGCAGGGGTGCGGGGGCTGG + Exonic
1121453727 14:94025609-94025631 GCGCGGGGGGCGGGGGCGGGGGG + Intergenic
1122543391 14:102509787-102509809 GGGCCAATGGCGGCGGCGGACGG - Exonic
1122620945 14:103057435-103057457 GGGCTGAGGGCGGCGGGGGCGGG - Exonic
1122666682 14:103334721-103334743 GCGCGCGGGGAGGGGGCGGCCGG - Intronic
1122750443 14:103928732-103928754 GCGGGCGGGGCGGAGGCGGCTGG + Intronic
1122779156 14:104136365-104136387 GTGCGGGGCGCGGCGGCGGCGGG + Intergenic
1122779168 14:104136406-104136428 GCGGGCGGGGCGGCGGTGGCGGG + Intergenic
1122889046 14:104724209-104724231 GCGCGGACGCCGGCGGCGGCGGG + Intronic
1124121694 15:26893884-26893906 GCGCGCGGGGCGGCGGCAGCCGG + Intronic
1124469223 15:29968604-29968626 GCGCGGAGCGGGGCGGGGGCCGG - Intronic
1124469322 15:29968971-29968993 CCACGCACGGCGGCGGCGGCGGG - Intergenic
1124469331 15:29969003-29969025 GTGGAAGGGGCGGCGGCGGCGGG - Intergenic
1126113286 15:45187757-45187779 GCGGGGGGGGCGGCGGCGGAGGG - Intronic
1127144111 15:56007289-56007311 GCGGGGGAGGCGGCGGCGGCGGG + Intergenic
1127144119 15:56007307-56007329 GCGGGGGAGGCGGCGGCGGCGGG + Intergenic
1127144127 15:56007325-56007347 GCGGGGGAGGCGGCGGCGGCGGG + Intergenic
1127144135 15:56007343-56007365 GCGGGGGAGGCGGCGGCGGCGGG + Intergenic
1127144143 15:56007361-56007383 GCGGGGGAGGCGGCGGCGGCGGG + Intergenic
1128139250 15:65286995-65287017 GGGCGGAGCGCGGCGGCGGGAGG - Intronic
1129299242 15:74615925-74615947 GCGACAGCGGCGGCGGCGGCCGG + Intronic
1129680582 15:77656491-77656513 GGGCGCAGGGCGGCTGCGGGGGG - Intronic
1130520611 15:84658277-84658299 GCGGGGAGGGCGGCGGGCGCGGG - Exonic
1132499891 16:280608-280630 GCGCCGAGCGGGGCGGCGGCGGG + Exonic
1132517060 16:370696-370718 CCGCGAAGGGCGGCACGGGCGGG + Intergenic
1132570552 16:642199-642221 GCGCAAAGGGCTGCGCCCGCGGG - Exonic
1132580904 16:684233-684255 GGGCGGAGGGCGACGGCGGGTGG - Exonic
1132834052 16:1943494-1943516 GCGCGAGGGGCGGCAGGGGCGGG - Intergenic
1132893235 16:2214787-2214809 GGCCGGCGGGCGGCGGCGGCCGG - Exonic
1132947278 16:2538373-2538395 GCGCGGAGGGCGGGGGAGGCCGG + Intronic
1132968438 16:2673083-2673105 GCGCGGAGGGCGGGGGAGGCCGG - Intergenic
1133784300 16:8963179-8963201 GCCCGAGGGCCGGCCGCGGCGGG - Intronic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1134614840 16:15643113-15643135 GTGCGCTTGGCGGCGGCGGCGGG - Exonic
1136399763 16:30010946-30010968 GCAGGCTGGGCGGCGGCGGCCGG + Exonic
1136550477 16:30979979-30980001 GGGCGGAGGGCGGCGGCGCCGGG - Exonic
1136867786 16:33770574-33770596 GCGGCAAAAGCGGCGGCGGCGGG - Intergenic
1138507693 16:57486376-57486398 GCGCGGCTGGCGGGGGCGGCAGG + Exonic
1139402941 16:66696653-66696675 GGGCGAGAGGCGGCGGCGGCGGG - Exonic
1139435470 16:66934347-66934369 CCGCGATGGTAGGCGGCGGCGGG - Exonic
1139652257 16:68368322-68368344 GAGCTAAGGGTGGCGGGGGCAGG + Intronic
1139917799 16:70438990-70439012 GCGCGGGCGGCGGCGGCGGCCGG - Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141054641 16:80804086-80804108 CGGCGGCGGGCGGCGGCGGCGGG - Intronic
1141171517 16:81694651-81694673 CCGGGAAGGGATGCGGCGGCAGG - Intronic
1141608501 16:85169023-85169045 ACGCGGGGGGAGGCGGCGGCGGG + Intergenic
1141683428 16:85556838-85556860 GCAGGAAGGGGGGCGGCGGGGGG - Intergenic
1142140641 16:88471281-88471303 TCGCGAAGGCCAGCGGCCGCAGG + Intronic
1142206266 16:88784677-88784699 GCTGGAAGGGCGGCGGCGGCTGG - Intronic
1142240171 16:88941356-88941378 GCGCGCGGGGCGGGGGCCGCGGG - Intronic
1142395282 16:89828394-89828416 GCGCGGAGGGCGCGGGGGGCGGG - Intronic
1142403423 16:89873119-89873141 GCTCGAGGGGCGGCGGCTCCAGG + Intergenic
1203104382 16_KI270728v1_random:1345677-1345699 GCGGCAAAAGCGGCGGCGGCGGG + Intergenic
1203129132 16_KI270728v1_random:1616691-1616713 GCGGCAAAAGCGGCGGCGGCGGG - Intergenic
1142549891 17:732274-732296 GCGGGAAGGGCCGCGGCTCCCGG - Intergenic
1142741094 17:1932427-1932449 GGGCTGAGGGCGGCCGCGGCTGG + Intergenic
1142752798 17:1998512-1998534 GCGCGCTGGGCAGCGGTGGCCGG - Intronic
1142854855 17:2723946-2723968 GCGGGAAGGGCGTCGGCGCGGGG + Intergenic
1143482956 17:7238006-7238028 GTGTGAAGGACGGGGGCGGCTGG - Intronic
1143493131 17:7295086-7295108 GTGCCAAGGGCGGTGGTGGCCGG - Intergenic
1143590783 17:7885058-7885080 GCGGCGGGGGCGGCGGCGGCGGG - Exonic
1143830304 17:9645685-9645707 GCGCAGGGAGCGGCGGCGGCGGG - Exonic
1144909953 17:18672675-18672697 TGGCGATCGGCGGCGGCGGCGGG - Intronic
1145327224 17:21842494-21842516 GCGCAAAAAGCCGCGGCGGCGGG - Intergenic
1145327262 17:21842638-21842660 CCGCAAAAAGCGGCGGCGGCGGG - Intergenic
1145327317 17:21842828-21842850 GCGCAAAAAGCCGCGGCGGCGGG - Intergenic
1145327428 17:21843293-21843315 GGGCAAAAAGCGGCGGCGGCGGG - Intergenic
1145327704 17:21844354-21844376 GCCCTCAGAGCGGCGGCGGCGGG - Intergenic
1146255885 17:31391532-31391554 GCGGCGGGGGCGGCGGCGGCGGG - Intergenic
1146716293 17:35089319-35089341 GCGCGGAGGGCGGGAGCGGCCGG - Exonic
1146935078 17:36808246-36808268 GCGCCAAGGGCGCCCGCGGAGGG + Intergenic
1147006312 17:37406817-37406839 GGCCGAGGGGCGGAGGCGGCGGG + Intronic
1147168660 17:38605854-38605876 GCTGGGAGGGCGCCGGCGGCCGG + Exonic
1147648907 17:42050783-42050805 GCGCGTGGGGCGGCAGGGGCTGG - Intronic
1147786305 17:42980825-42980847 GCGGGCAGAGCGGCGGCGGCTGG + Exonic
1148225254 17:45894735-45894757 GGGCGAGGGGCGGCGGCGCAGGG - Intronic
1148549994 17:48544544-48544566 GCCGGAACGGCGGAGGCGGCCGG + Exonic
1148555795 17:48577950-48577972 GGGCGCAGGGAGGCGGCGGGGGG + Exonic
1148786837 17:50149733-50149755 GGGCGGGCGGCGGCGGCGGCGGG + Exonic
1148825212 17:50388072-50388094 GCGGGAGAGGCAGCGGCGGCTGG - Exonic
1149849325 17:60026027-60026049 GTCAGAGGGGCGGCGGCGGCCGG - Intergenic
1149860843 17:60120497-60120519 GTCAGAGGGGCGGCGGCGGCCGG + Intergenic
1150002664 17:61451661-61451683 GGGTGCGGGGCGGCGGCGGCAGG - Intergenic
1150133218 17:62680342-62680364 GAGCGAAGGGTGGCGGGGCCAGG + Intronic
1150168408 17:62966388-62966410 GCGCGGAGGGCGGTGGCGGCGGG - Intergenic
1150643449 17:66964574-66964596 ACCCGGAGCGCGGCGGCGGCGGG + Intergenic
1152354311 17:79799297-79799319 GCTCGAGGGGCTGAGGCGGCCGG - Intronic
1152362539 17:79839348-79839370 GGGCGAGCGGCGGCGGCGGCGGG - Exonic
1152433104 17:80260508-80260530 GCGGGGCCGGCGGCGGCGGCGGG + Intergenic
1152617839 17:81346039-81346061 CCCCGGAGGGCGGCGGCCGCGGG - Intergenic
1152703959 17:81833350-81833372 TGGCGGAGGGCGGGGGCGGCCGG + Intergenic
1152714337 17:81891347-81891369 GCGCGGCCGGCGGAGGCGGCAGG - Exonic
1152789895 17:82273276-82273298 GGGCGGCGGGCGGGGGCGGCGGG + Intronic
1152924155 17:83079884-83079906 GCGGGAGCGGCGGCGGGGGCGGG - Exonic
1203192142 17_KI270729v1_random:199763-199785 GCGCGAAAAGCCGCGGGGGCGGG - Intergenic
1153855093 18:9137221-9137243 CCGGGAGGGGCGGCGGCGGGCGG - Intronic
1154266456 18:12883476-12883498 TCGCAGAGGGCTGCGGCGGCCGG + Intronic
1155519790 18:26656748-26656770 GCGCAGGGGGCGGCGGCGCCCGG - Intronic
1155654571 18:28178001-28178023 GCGAGGGCGGCGGCGGCGGCGGG - Intergenic
1155910355 18:31498210-31498232 GCGCGGAGCGGTGCGGCGGCGGG + Exonic
1156502016 18:37566135-37566157 GCGCCACGGCGGGCGGCGGCCGG + Intergenic
1157095091 18:44680168-44680190 GCGGGAAGCGCGGGGCCGGCCGG + Intronic
1157384123 18:47247701-47247723 GCGCCGAGGGCGGCTGAGGCGGG + Intronic
1158976543 18:62715868-62715890 GCGGGAACGGCAGCGGCAGCGGG + Exonic
1159021234 18:63144874-63144896 GTGCCCAGGGCGGCGGGGGCGGG - Intronic
1160025083 18:75209707-75209729 GCGCGTGCGGCAGCGGCGGCAGG - Intergenic
1160453616 18:78980716-78980738 ACGCTGAGGCCGGCGGCGGCGGG + Intronic
1160577247 18:79863684-79863706 GCTCCCCGGGCGGCGGCGGCGGG + Exonic
1160788696 19:913045-913067 GCGCGGCGGGCGCCGGGGGCGGG - Intronic
1160871700 19:1280755-1280777 GAGCGGGGGGCGGCGGCGGCTGG - Intergenic
1160882053 19:1325364-1325386 CCGCGGCGGGGGGCGGCGGCCGG + Intergenic
1160906035 19:1452115-1452137 GCGTGAAGGGGGGCTCCGGCGGG + Exonic
1161130974 19:2588529-2588551 GAGCCCAGGGCGGCGGCAGCTGG + Intronic
1161702973 19:5805056-5805078 GCGGGACGGGCGGAGGCGGCGGG + Intergenic
1162041166 19:7971780-7971802 GAACGAAGGCCGGCAGCGGCAGG + Intronic
1162393781 19:10404756-10404778 GGGGGAAGGGCGGCAGCGGGAGG - Intronic
1162398773 19:10432389-10432411 GCGCGCATGGGGACGGCGGCAGG - Intronic
1162535828 19:11262452-11262474 GGGCCCGGGGCGGCGGCGGCGGG - Exonic
1162731420 19:12721214-12721236 GGGCCACAGGCGGCGGCGGCGGG + Intronic
1162778685 19:12995718-12995740 GGGCGCAGCGCGGCGGAGGCCGG + Exonic
1163551171 19:17967155-17967177 GGGCCGGGGGCGGCGGCGGCAGG - Intronic
1163782508 19:19257865-19257887 GCTGGGCGGGCGGCGGCGGCTGG - Exonic
1164639307 19:29812499-29812521 GCGCGGGGTGAGGCGGCGGCGGG - Intronic
1164693629 19:30227864-30227886 GCGCGGAGGGGGCCGGCGGAGGG + Intergenic
1165858648 19:38895057-38895079 GCGAGGAGGGAGGCGGGGGCAGG - Intronic
1165941740 19:39417901-39417923 GCAGGAAGTGCAGCGGCGGCTGG + Exonic
1166002537 19:39886270-39886292 GCGGGCAGGTGGGCGGCGGCAGG + Exonic
1166005323 19:39902522-39902544 GCGGGCAGGTGGGCGGCGGCAGG + Exonic
1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG + Exonic
1166375227 19:42324062-42324084 GGGCGAACTCCGGCGGCGGCCGG - Intronic
1166721791 19:45001385-45001407 GCGCGCAGGCCGGCGGCGCCGGG + Intergenic
1166734497 19:45076132-45076154 GCGAGGAGGGCGGCCCCGGCGGG + Exonic
1166888257 19:45973957-45973979 GCGCGGGCGGCGGCGGCGACGGG + Intergenic
1167369655 19:49072835-49072857 GCGCGGGCGGCGGCGGCGGCGGG - Exonic
1167445392 19:49534216-49534238 GCGCGGGGGACGGCGACGGCTGG + Exonic
1167643660 19:50694961-50694983 GCGCGGGGGGCGGCTGCGGCAGG + Intronic
1167738686 19:51311715-51311737 GCCCGGGGGGCGGCGGGGGCGGG - Intergenic
1167743890 19:51340034-51340056 CAGCGAGCGGCGGCGGCGGCCGG + Exonic
1168154509 19:54465316-54465338 GCGGGACGGCGGGCGGCGGCGGG + Exonic
1202683795 1_KI270712v1_random:31150-31172 GGGCGAAAAGCCGCGGCGGCGGG - Intergenic
925105707 2:1289298-1289320 GAGGGAAGGGCGGCGGCAGAAGG - Intronic
925609790 2:5693143-5693165 GCGCGGCCGGCGGCGGCGGCGGG + Exonic
926077212 2:9951321-9951343 GCGGGGACGGCGGGGGCGGCGGG + Intergenic
926190065 2:10721669-10721691 GGGCGACGGGCGGCGGGTGCGGG - Exonic
927606569 2:24491510-24491532 GCCCGAGGAGCGGCGGAGGCCGG + Intergenic
929174231 2:38960550-38960572 GCGGCGACGGCGGCGGCGGCCGG - Exonic
929188602 2:39120448-39120470 GGGAGAGGGGCGGCGGCGGCCGG + Exonic
930136051 2:47905423-47905445 GCGGGAAGGGAGGCCGGGGCGGG - Intronic
932416000 2:71574286-71574308 GCGCCAGCGGCGGCGGCGGAAGG - Exonic
932780603 2:74556327-74556349 GCCTGAGGGGCAGCGGCGGCCGG - Exonic
934685990 2:96321975-96321997 GGGCGAAGGGAGGCGGCTCCTGG + Intergenic
934856481 2:97733232-97733254 GGGCGGTGGGCGGGGGCGGCAGG + Intronic
934933133 2:98444856-98444878 GCGTCTAGAGCGGCGGCGGCTGG + Exonic
935301615 2:101697929-101697951 GGGCCGCGGGCGGCGGCGGCGGG - Intronic
935757657 2:106289066-106289088 GCGCGCAGTGTGGCGGCAGCAGG - Intergenic
937183138 2:120013448-120013470 GCGCGACGGGCCGGGGCGGAGGG + Intronic
937208609 2:120252947-120252969 GTGCGGACGGCGGAGGCGGCGGG + Exonic
938406243 2:131034874-131034896 GCGGGGGCGGCGGCGGCGGCGGG - Intronic
938518395 2:132038708-132038730 GCGCAAAAAGCCGCGGCGGCGGG + Intergenic
941020926 2:160407532-160407554 TCGCTGCGGGCGGCGGCGGCGGG + Intronic
941951495 2:171160834-171160856 GCCCGGGAGGCGGCGGCGGCGGG + Intronic
942083999 2:172427737-172427759 GAGCGCAGGGCGGCCGCTGCAGG + Intronic
942151066 2:173076161-173076183 GCCCGCCCGGCGGCGGCGGCCGG + Intronic
942450907 2:176107603-176107625 GCGCGGGGGGCGGCAGCAGCGGG + Exonic
942890368 2:180980635-180980657 CCGAGCCGGGCGGCGGCGGCGGG + Exonic
945225911 2:207530581-207530603 GCGAGGCGGGCGGCGGGGGCCGG - Intronic
945891602 2:215436199-215436221 GCGCGGTCGGCTGCGGCGGCCGG - Intergenic
946019856 2:216633600-216633622 GCGCGAGTGGCGGCGGCGGCGGG + Exonic
947593080 2:231395970-231395992 GCGGGCGCGGCGGCGGCGGCGGG + Intronic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
948473799 2:238203647-238203669 GGGCGACGGGCAGGGGCGGCCGG + Exonic
948628250 2:239283987-239284009 GCGCCAAGGGCGTCGGCGCAGGG + Intronic
948645321 2:239400691-239400713 CCGCGGCGGGCGGCGGCGGCCGG + Exonic
948933710 2:241149250-241149272 GCGCGAAGGGCGACGGGCGCAGG + Intronic
1170578470 20:17681525-17681547 GGGCGGAAGGCGGCGGAGGCCGG - Intronic
1171123420 20:22583684-22583706 GTGCGGAGTGCGGGGGCGGCTGG + Intronic
1171175464 20:23048681-23048703 GCCTGCAGGGCGGCGCCGGCTGG + Exonic
1172587285 20:36093510-36093532 GGGCGGTGGGTGGCGGCGGCGGG + Intronic
1175443875 20:59007462-59007484 GCGCTCAGGGCGGCGGCCGGCGG - Intergenic
1175847096 20:62064982-62065004 GCGCGGGGGGTGGCGGGGGCGGG + Exonic
1175847238 20:62065368-62065390 GCGGCGACGGCGGCGGCGGCGGG + Exonic
1175873681 20:62219900-62219922 GCGGGCGAGGCGGCGGCGGCGGG - Exonic
1177431696 21:20998284-20998306 GCGGGGAGGGCGGCGGGGGCGGG - Intergenic
1178104084 21:29299117-29299139 CCGCGGGGGGCGCCGGCGGCCGG + Intronic
1179243754 21:39612825-39612847 CCGCGCAGGGCGGCGCGGGCTGG - Intronic
1179495222 21:41767024-41767046 GCGCGATGGAGGGCGACGGCGGG - Exonic
1180843633 22:18970427-18970449 GCGCGGGAGGCGGCGGCGGGCGG - Intergenic
1181017643 22:20080395-20080417 GCGCGAGGGGCGCCCGCGGGCGG + Intronic
1181283400 22:21735754-21735776 GCCCGCGGGGCGGCGGCGGGAGG - Exonic
1181813710 22:25421139-25421161 GCGCGGCGGGCGGCGGCCGCGGG + Intergenic
1181831672 22:25564961-25564983 GCGCGGCGGGCGGCGGCGGCGGG + Exonic
1182236972 22:28883727-28883749 GCGCGGAGGGCGGGCGCGGCCGG - Exonic
1182567683 22:31212306-31212328 GCGCCTGAGGCGGCGGCGGCAGG + Intronic
1183702155 22:39457063-39457085 CGGCGCGGGGCGGCGGCGGCCGG + Intergenic
1183912953 22:41092459-41092481 GCGCGGAGCGCGGCGGCAGGAGG + Exonic
1185278622 22:49960654-49960676 GCCCGCGAGGCGGCGGCGGCCGG - Exonic
1185278856 22:49961379-49961401 GCACGGGCGGCGGCGGCGGCGGG + Intronic
949414241 3:3799301-3799323 GCGCCGAGGGCGGGGGCGGGAGG + Intronic
950023626 3:9806290-9806312 CCGAGCAGCGCGGCGGCGGCAGG + Exonic
950404581 3:12796795-12796817 GAGAGAAGGGGGCCGGCGGCGGG - Intronic
950544157 3:13629055-13629077 GCTGGCAGGGCGGAGGCGGCTGG - Intronic
952816477 3:37452058-37452080 GCGGCCCGGGCGGCGGCGGCTGG - Intergenic
952889201 3:38029686-38029708 GGGCGCAGGGCAGCGGGGGCGGG - Intronic
954256644 3:49411973-49411995 GAGCGAGGGCGGGCGGCGGCGGG + Exonic
954367564 3:50154718-50154740 GCGAGAAGGGCTGCAGCGCCAGG - Intergenic
954702022 3:52455543-52455565 GGGCGACGGGCGGCGGGGGCCGG + Exonic
954838955 3:53494714-53494736 GCGGCGCGGGCGGCGGCGGCGGG + Intronic
956414661 3:69013507-69013529 GCGCAGAGCGCTGCGGCGGCGGG + Intronic
956892273 3:73624553-73624575 ACGCGACGCGCGGCTGCGGCCGG - Exonic
959085817 3:101849746-101849768 GCGCCCGGGGCGGCGGCGGGCGG - Exonic
961077041 3:123992048-123992070 GCGGGGAGGGCAGCAGCGGCCGG + Intronic
961307535 3:125969252-125969274 GCGGGGAGGGCAGCAGCGGCCGG - Exonic
961340351 3:126213189-126213211 CGGCGAAGGGCCGCGGCCGCCGG - Intergenic
963733140 3:148991698-148991720 AGGAGAAGGGAGGCGGCGGCTGG - Intronic
964118866 3:153162246-153162268 GCGCGATGGGCCGCGGCGGTGGG + Intergenic
965520376 3:169663801-169663823 GCGGGGAGGGCGGCGGGGGGCGG + Intergenic
965590655 3:170357736-170357758 GCGGCGACGGCGGCGGCGGCGGG + Intronic
966911417 3:184562250-184562272 GCGGCGACGGCGGCGGCGGCGGG - Exonic
967858163 3:194134014-194134036 GCGGGAAGGGCTGAGGGGGCGGG + Intergenic
967867845 3:194204597-194204619 CCGGGAGGGGCGGCGGGGGCCGG - Intergenic
968606375 4:1537616-1537638 GAGCCAAGGGCGGCGGCGCCAGG + Intergenic
968701281 4:2059347-2059369 GGGCGCGGGGCGGAGGCGGCGGG - Intergenic
968724860 4:2242082-2242104 GCACGGAGGGCGGTGGCGGCGGG - Exonic
968820007 4:2843498-2843520 GTGCGCTGGGCGGCGGCGGGAGG + Intergenic
968940555 4:3635290-3635312 GGGCGAAGGGCGGGAGCAGCGGG + Intergenic
969330747 4:6472375-6472397 GGGGGACGGGCGGGGGCGGCCGG + Intronic
971351932 4:25862971-25862993 GCGGCAGTGGCGGCGGCGGCGGG - Intronic
973551283 4:52038269-52038291 GCGGGGAGCTCGGCGGCGGCGGG - Exonic
973820552 4:54658401-54658423 GCGCGGGGGGCGGAGGCGGGGGG + Intronic
975689452 4:76949728-76949750 GCGGGAGGGGCGGCGGCGTGGGG + Exonic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
977666240 4:99649944-99649966 GGGTGAAGGGCAGCGGCGGCTGG + Exonic
981550600 4:145937740-145937762 GCGGCAGCGGCGGCGGCGGCTGG - Intronic
982522436 4:156435863-156435885 GCGCCACGGGAGGCGGAGGCAGG - Intergenic
983939564 4:173525614-173525636 GCGGGAAGGGGGGAGGAGGCTGG - Intronic
983941621 4:173538843-173538865 GCGCGGGGGGAGGCGGCGGAGGG + Intergenic
985550140 5:528661-528683 GCGCGGGGCGGGGCGGCGGCCGG - Intergenic
985660711 5:1155518-1155540 GCGCGGCGGGCGGCAGGGGCGGG + Intergenic
985660853 5:1155904-1155926 GCGGGGAGGGCGGGGCCGGCGGG + Intergenic
985888862 5:2700420-2700442 GCCCGAAGGGCGGTGGCCACAGG - Intergenic
985995645 5:3595715-3595737 GCGGGAGGGGCGGGAGCGGCCGG + Intergenic
985995742 5:3596039-3596061 GCGGGGAGGGAGGCGGAGGCCGG - Exonic
990545230 5:56815568-56815590 GAGAAAATGGCGGCGGCGGCGGG + Exonic
992013875 5:72556982-72557004 GAGCGAAGGGCGGCGGGGAGGGG + Intergenic
992105611 5:73447504-73447526 GCGCGTAAGGCGGCAGCTGCAGG + Exonic
992487519 5:77210642-77210664 GCGGGGAGGGTGGCGGCCGCTGG + Intronic
993501937 5:88674956-88674978 GCGCGCAGGGCTGCCGCGGGCGG + Intergenic
996184964 5:120464220-120464242 GAGCGCCGGGCGGCGGCGGGAGG + Intergenic
997585218 5:135039788-135039810 GGGCGACGGGCGGCGGCGGCGGG - Intronic
997675191 5:135707512-135707534 GACCCAAGGGCGGGGGCGGCGGG - Intergenic
998018806 5:138753287-138753309 GCGGGCGGGGCGGCGGCGGGAGG + Intronic
998136563 5:139677211-139677233 GCGGGCAGGCGGGCGGCGGCGGG - Intronic
1001064988 5:168529360-168529382 GGGCGGCGGGCGGCGGGGGCAGG - Exonic
1001514552 5:172346225-172346247 GCGGGATGGGCGGCTTCGGCAGG + Exonic
1001688744 5:173616413-173616435 TGGCGGACGGCGGCGGCGGCGGG - Exonic
1002180056 5:177426683-177426705 GCGCGGCTGGCTGCGGCGGCCGG + Intronic
1004174544 6:13328429-13328451 GCGGGAAGGAGGGAGGCGGCGGG + Intronic
1005327890 6:24720278-24720300 GCGGAAGAGGCGGCGGCGGCGGG + Exonic
1005512156 6:26520923-26520945 GCGGGGAGGGCTGCGGCGGGTGG - Intergenic
1005987767 6:30884786-30884808 GGGCGAGGGGCGGGGGAGGCAGG + Intronic
1006136227 6:31897661-31897683 GCGGCGATGGCGGCGGCGGCGGG - Exonic
1006304108 6:33208601-33208623 GGGAGAGGCGCGGCGGCGGCGGG + Exonic
1006472511 6:34236747-34236769 GCGGCAGCGGCGGCGGCGGCTGG + Intergenic
1006725498 6:36196788-36196810 CCGGGAGCGGCGGCGGCGGCCGG + Exonic
1006851629 6:37102768-37102790 GGGCGAGGGGCCGGGGCGGCCGG - Intergenic
1007424053 6:41735485-41735507 GCGGGAAGGGCGGACGGGGCGGG - Intronic
1007444514 6:41895023-41895045 GCGCCCGGGGCGGGGGCGGCGGG - Intronic
1007597401 6:43059969-43059991 GTGAGATGGGCGGGGGCGGCAGG - Exonic
1007629130 6:43263104-43263126 GGGCGAAGAGCGGCGGCGGCTGG + Exonic
1008053929 6:46927286-46927308 GAGCAAAGGGCGGCGGGGGTGGG + Intronic
1010414869 6:75601806-75601828 GCGCTGGGGGCGGCGGCGTCGGG + Intronic
1010703128 6:79077105-79077127 GCGCGAGAGTCGGCGGCGGCGGG - Intronic
1011470376 6:87701990-87702012 GAGCGGACGGCGGGGGCGGCCGG - Exonic
1012887255 6:104859846-104859868 GCGCGAGCAGAGGCGGCGGCGGG - Exonic
1013273359 6:108561438-108561460 TGGCGATCGGCGGCGGCGGCGGG + Exonic
1014137743 6:117907923-117907945 GCGCGGGGGGCGGGGGCTGCGGG + Intronic
1014272189 6:119348485-119348507 TCGCGGATGGCGGCGTCGGCGGG + Exonic
1014724951 6:124962561-124962583 GCACGGTGAGCGGCGGCGGCGGG + Exonic
1015315014 6:131807934-131807956 CCGCGAGGGGCGGGCGCGGCGGG + Intergenic
1015826186 6:137314432-137314454 GGGGGAGGGGCGGGGGCGGCAGG - Intergenic
1015904886 6:138107097-138107119 GCGGCGACGGCGGCGGCGGCGGG + Intronic
1017163955 6:151390921-151390943 GCGCCCTGGGCGGCGGCGGCCGG - Intronic
1017810780 6:157981970-157981992 GAGCAAAGGGCTGCGGCTGCTGG + Exonic
1018050818 6:160006211-160006233 GCGCGAAGGGGGGAGGCGCGAGG - Intronic
1019111897 6:169723915-169723937 GGGCTGATGGCGGCGGCGGCCGG - Exonic
1019111917 6:169723981-169724003 GCGGCAGCGGCGGCGGCGGCCGG - Exonic
1019198350 6:170295548-170295570 GCGCGAAGGTGGGCGACGGTGGG + Intronic
1019421746 7:954128-954150 GGGGGAGGGGAGGCGGCGGCAGG + Intronic
1019562565 7:1665874-1665896 GAGCGCGGGGCGGCGGCGGCGGG - Intergenic
1020198173 7:6058801-6058823 GTGCGAGGGGGGGCGGCGGGCGG - Intronic
1022207700 7:28180080-28180102 GCGCGGCGGGCGGCGGGAGCTGG - Intronic
1022410373 7:30135095-30135117 GCGGGAGGGCGGGCGGCGGCGGG + Exonic
1022989590 7:35694820-35694842 GCGCGGAGGGCGGCGGTGGCGGG - Exonic
1023638778 7:42237871-42237893 GCGAGGCGGGCGGCGGCGGCTGG + Intergenic
1024579878 7:50793102-50793124 GAGCGCTGGGCGGCCGCGGCCGG - Intronic
1024580023 7:50793574-50793596 GCGGTCCGGGCGGCGGCGGCGGG - Intergenic
1026047976 7:66921248-66921270 GCCCGAACTGAGGCGGCGGCGGG + Exonic
1026765056 7:73155089-73155111 GCGCGGGGGGCGGCGGCGGCCGG - Intergenic
1027041529 7:74964844-74964866 GCGCGGGGGGCGGCGGCGGCCGG - Exonic
1027082113 7:75237525-75237547 GCGCGGGGGGCGGCGGCGGCCGG + Intergenic
1028193272 7:87876350-87876372 GCGAGAAGGACGGCGGCGTGAGG + Exonic
1028268668 7:88759595-88759617 GCGCGAAGGCAGGGGGCGGGAGG + Exonic
1028556832 7:92134348-92134370 GAGTGAATGGCGGCGGCGGCTGG - Exonic
1029390694 7:100272071-100272093 GCGCGGGGGGCGGCGGCGGCCGG + Exonic
1029491849 7:100875046-100875068 GCGCGAAGGGCGGGGAGAGCAGG - Intergenic
1029495833 7:100895235-100895257 CCGCTCAGGGCGGCGGGGGCTGG - Intronic
1029708315 7:102286783-102286805 GCGCGAGGGGGGGCGGGGCCGGG + Intronic
1029821221 7:103149365-103149387 GCGGGAGGGGCGACCGCGGCAGG + Intronic
1030055841 7:105583161-105583183 GCGCTGAGGGCGGGGGCGGCGGG + Intronic
1030055865 7:105583204-105583226 GGGGGAAAGGCGGGGGCGGCGGG + Intronic
1032020736 7:128406048-128406070 GCGAGAAGGGCGGGAGGGGCGGG - Intronic
1032074533 7:128830240-128830262 GGGGGAGGGGCGGCGGGGGCGGG + Intergenic
1033220497 7:139523960-139523982 CGGCGAGGGGCGGCGGCGGCCGG - Exonic
1033253112 7:139777557-139777579 CCGCGGAGGGCGGCGGGCGCGGG + Intronic
1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG + Intergenic
1033477187 7:141702177-141702199 GCGCGAGGGGCGGGGCGGGCGGG + Intergenic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034426920 7:151018791-151018813 GTGCGCAGGAAGGCGGCGGCGGG + Exonic
1034441043 7:151086323-151086345 GAGCGAGGGGCGGGGGCGCCCGG + Intronic
1034441059 7:151086354-151086376 GCAGGAGGGGCGGGGGCGGCGGG + Intronic
1034448589 7:151125837-151125859 GCTGGGAGGGAGGCGGCGGCGGG + Intronic
1034895880 7:154876041-154876063 GCACGAAGTGAGGCGGCGGCTGG + Exonic
1035191923 7:157177538-157177560 ACGCAAAGGGCAGCGGCGGGCGG - Intronic
1036910673 8:12755064-12755086 GCGCTGACGGCGGCGCCGGCGGG - Exonic
1038176373 8:25184830-25184852 GAGCGCGGGGCGGCGGCGGCCGG + Intronic
1038644031 8:29348848-29348870 GCGCGGAATGCGGCGGCGGGAGG + Intronic
1039545100 8:38404281-38404303 GCGGAAAGGGCGGGGGCGGTGGG + Intronic
1039921480 8:41896832-41896854 GCTCGTACTGCGGCGGCGGCGGG + Intergenic
1041167261 8:55102322-55102344 GGGCGGCGGGCGGCGGCGGACGG + Intergenic
1041712960 8:60910125-60910147 ATGCGAAGGGCGCCGGGGGCGGG - Intergenic
1042190046 8:66177315-66177337 GCTCGGACTGCGGCGGCGGCTGG + Exonic
1045305090 8:100951511-100951533 GCGAGAAGGGCGGCGAGGGAGGG + Intronic
1045305205 8:100951897-100951919 AAGCGAGGCGCGGCGGCGGCCGG + Intronic
1045489072 8:102655696-102655718 GCGCTGAGCGCGGCGGCGGCGGG - Exonic
1046547432 8:115669110-115669132 TCCCGGCGGGCGGCGGCGGCGGG - Intronic
1047381780 8:124371735-124371757 GGCGGAAGGGGGGCGGCGGCGGG + Intronic
1048981174 8:139703924-139703946 GCGGGCGCGGCGGCGGCGGCGGG + Intergenic
1049109666 8:140635308-140635330 GCTCGAGGAGCGGCGGCGGCGGG - Intronic
1049396441 8:142403190-142403212 GCGCGCACGCCGGCGGCGGGAGG - Intronic
1049405405 8:142449961-142449983 GGGCCGGGGGCGGCGGCGGCTGG + Exonic
1049532253 8:143160365-143160387 GCGCGGGGGGCGGGGGCGGCTGG + Intronic
1049558540 8:143296013-143296035 GCGCAGAGGGCGGGGGCAGCTGG + Exonic
1049707368 8:144049160-144049182 GCGGGAAGGGCGAGGGCCGCGGG - Intergenic
1049711127 8:144063853-144063875 GAACGAAGAGCTGCGGCGGCTGG - Intergenic
1052494935 9:29213484-29213506 GGGCGGCGGGCGGCGGCGCCAGG + Intergenic
1053786355 9:41655264-41655286 GCGGGAGGGGAGGCGGAGGCGGG + Intergenic
1054175076 9:61869220-61869242 GCGGGAGGGGAGGCGGAGGCGGG + Intergenic
1054407310 9:64773676-64773698 GCGCAAAAAGCCGCGGCGGCGGG + Intergenic
1054662461 9:67711573-67711595 GCGGGAGGGGAGGCGGAGGCGGG - Intergenic
1055030792 9:71769636-71769658 GGGGGCAGGGTGGCGGCGGCAGG - Intronic
1055945715 9:81689506-81689528 GCGCGGGCGGCGGCGGCGGTGGG - Intergenic
1056154049 9:83817558-83817580 GCGGGAGAGGCGGCGGCGGGGGG - Exonic
1056170502 9:83980363-83980385 GCCCGAAGGGAGGCGCTGGCGGG - Intronic
1056356448 9:85805535-85805557 GCGGGAGAGGCGGCGGCGGGGGG + Intergenic
1057245540 9:93451700-93451722 GCGGCAGCGGCGGCGGCGGCAGG + Exonic
1057643780 9:96854183-96854205 GCGCGAGCGGCGGCGGGGGTGGG - Exonic
1058923511 9:109640441-109640463 GGGAGCAGGGCGGCTGCGGCTGG - Intergenic
1059375212 9:113876107-113876129 GCGGGCAGGGCGGCGGGGGGCGG + Intergenic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1061181664 9:129028209-129028231 GTGCGGTTGGCGGCGGCGGCTGG - Exonic
1061299701 9:129697564-129697586 CCGGGCTGGGCGGCGGCGGCTGG + Intronic
1061321829 9:129835642-129835664 GGGAGAGGGGCGGCGGCGGCCGG - Intronic
1061450348 9:130664119-130664141 GCGCGAGGGGCGGGGGCGCGCGG - Intergenic
1061666415 9:132162990-132163012 GGGCTGGGGGCGGCGGCGGCCGG + Intronic
1062230683 9:135479994-135480016 GCGCGGCGGGCGGCGGGGGACGG + Exonic
1062500120 9:136848657-136848679 GCGCGGGGCGCGGCGGCGGGTGG - Exonic
1062600314 9:137316296-137316318 GCGCGAAGGCCGCGGGCGGGCGG - Intronic
1203616832 Un_KI270749v1:73377-73399 GCGGGAAAGACCGCGGCGGCAGG - Intergenic
1187053753 X:15720276-15720298 GGGCGGAGGGCGGCTGAGGCAGG - Intronic
1187950480 X:24465591-24465613 GCCCGAATGGCGGCGGCCCCGGG - Intronic
1189446478 X:41085605-41085627 GAGAGAGAGGCGGCGGCGGCGGG - Intergenic
1190024664 X:46912539-46912561 GCGCGGGGGGCGGCCCCGGCGGG + Exonic
1190385522 X:49879591-49879613 GCGGGGAAGGCGGAGGCGGCGGG + Intergenic
1192260820 X:69505036-69505058 GCGGGCCGGGCGGCGGCGCCCGG + Intergenic
1195273271 X:103254172-103254194 GCGCGAAGGGAGGTGGAGTCAGG - Intronic
1197782444 X:130171686-130171708 GGCCGAGGCGCGGCGGCGGCTGG + Exonic
1197941644 X:131795976-131795998 GCGCGAAGGGCTGCGCCCGCTGG + Intergenic
1198388139 X:136147717-136147739 CCCCGAGCGGCGGCGGCGGCGGG - Intronic
1199724554 X:150568285-150568307 GGGCGCCGGGCGGAGGCGGCTGG - Intergenic
1199772507 X:150983773-150983795 GGGCGCTGGGCGGCGGCAGCGGG + Intronic
1200213290 X:154356410-154356432 GTGCGCAGGGCGGGGGAGGCTGG - Intronic