ID: 1166227546

View in Genome Browser
Species Human (GRCh38)
Location 19:41406025-41406047
Sequence TTGGCCACCCACTCCCATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166227545_1166227546 -10 Left 1166227545 19:41406012-41406034 CCTCTGCAGGCATTTGGCCACCC 0: 1
1: 0
2: 2
3: 17
4: 173
Right 1166227546 19:41406025-41406047 TTGGCCACCCACTCCCATTATGG 0: 1
1: 0
2: 0
3: 10
4: 91
1166227544_1166227546 -6 Left 1166227544 19:41406008-41406030 CCTTCCTCTGCAGGCATTTGGCC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1166227546 19:41406025-41406047 TTGGCCACCCACTCCCATTATGG 0: 1
1: 0
2: 0
3: 10
4: 91
1166227538_1166227546 29 Left 1166227538 19:41405973-41405995 CCAAAAACTAGAGGAACAGATGG 0: 1
1: 0
2: 1
3: 22
4: 261
Right 1166227546 19:41406025-41406047 TTGGCCACCCACTCCCATTATGG 0: 1
1: 0
2: 0
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166227546 Original CRISPR TTGGCCACCCACTCCCATTA TGG Intronic
902639943 1:17760717-17760739 TTGTCCACCCACTCCTCTGAGGG - Intronic
902739323 1:18423835-18423857 CTGACCACCCATTCCCATCATGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906276738 1:44522540-44522562 TTGTCCACCCACCTCAATTAAGG - Intronic
908175834 1:61554307-61554329 TTGGCCACCCAGTCCCAGGAAGG + Intergenic
909965375 1:81902718-81902740 CTGACCACCCATTCCCATCATGG + Intronic
911347585 1:96715760-96715782 GAGGCCACCCATTCCCATCAGGG + Intergenic
918132368 1:181640928-181640950 TTGGTCCTCCATTCCCATTAGGG - Intronic
918190361 1:182168104-182168126 ATGGCCACCCTCTACTATTATGG + Intergenic
919099303 1:193074251-193074273 TTGACCAAGCAATCCCATTACGG - Intronic
920366113 1:205449273-205449295 TTCCCCACCCGCTCCCATGACGG + Intronic
920449767 1:206051114-206051136 TTGGCCACCCACACCCAGGCAGG + Intronic
923273239 1:232375953-232375975 TTGTCCACCAAGTCCAATTAGGG + Intergenic
1067341466 10:45408671-45408693 TTAGCCACCCATTCCTATCATGG + Intronic
1074783335 10:116818093-116818115 CTGGCCACACACTGCCAGTAGGG + Intergenic
1077103460 11:832263-832285 TCGGCCACCCCCTCCCATGCTGG + Intergenic
1077131325 11:974176-974198 CGGGCCACCCACTCCCTTCATGG - Intronic
1077131337 11:974220-974242 CGGGCCACCCACTCCCTTCATGG - Intronic
1082116979 11:48338974-48338996 TGGGCCACCCACACTCATAATGG - Intergenic
1082855150 11:57799336-57799358 CTGGCCACCCACACCCATCTGGG - Intronic
1084790214 11:71470555-71470577 TTGGCCACAGACTTCCTTTATGG - Intronic
1087370415 11:97277111-97277133 TTGGCCCAGCAATCCCATTACGG + Intergenic
1089682232 11:120125015-120125037 TTTTCCACCCAGTCCCTTTAGGG - Intronic
1089985288 11:122807148-122807170 TTAGCCACTCACTACCATAAAGG + Intronic
1091573708 12:1713507-1713529 ATGCCCACCCACTCCAAATAAGG - Intronic
1096584810 12:52613191-52613213 CTTCCCACCCACTACCATTAGGG + Intronic
1096588792 12:52643753-52643775 TGAGCCACCAACTCCCATTTGGG + Intergenic
1097923449 12:65102474-65102496 TTGGAGACCCACCCACATTAGGG + Intronic
1099928512 12:89046851-89046873 TTAGCTGCCCATTCCCATTATGG - Intergenic
1101246698 12:102890549-102890571 TTGGTCACCCAATCCCATAGTGG - Intronic
1111709721 13:91796038-91796060 GTGGCCAGCCACTCCCAAGATGG + Intronic
1112351113 13:98634174-98634196 TTGGCCAGGCACTCTCATTCAGG - Intergenic
1130342651 15:83012289-83012311 CAGGCCACCCTCTCCCATTTAGG - Intergenic
1130366963 15:83249414-83249436 TTTGTCACCCACTCCCATCAGGG + Intergenic
1131937165 15:97519372-97519394 TTGGCCATCCACTAGCATGAGGG + Intergenic
1136576461 16:31128133-31128155 CTGGCCACCCACTCACCTTATGG - Exonic
1147879645 17:43645714-43645736 CTCGCCACCCACTCCCAATGCGG - Intronic
1156246478 18:35304258-35304280 CTGGCCAGCAACTGCCATTAGGG - Intergenic
1157018237 18:43745179-43745201 CTGACCACCCATTCCCATCATGG + Intergenic
1157046114 18:44103698-44103720 TGGGCCACCCAGACCCATAATGG - Intergenic
1160971572 19:1770012-1770034 TTGCCCAGCCAGTCCCAATAGGG - Intronic
1163669417 19:18618568-18618590 TTGGCCACCTGCTCCCATGGAGG + Intronic
1166227546 19:41406025-41406047 TTGGCCACCCACTCCCATTATGG + Intronic
928320991 2:30282780-30282802 TGGGCCACCCAGTCCCACTCTGG + Intronic
934537243 2:95145244-95145266 CTGACCACCCATTCCCATCATGG - Intronic
938073248 2:128319096-128319118 TTGGTCCCCCACTCCCCTGAGGG - Intergenic
939022922 2:136980374-136980396 GTGGCCACCCCCTCCCAACAGGG + Intronic
939861041 2:147420681-147420703 TTGGCCAGGCACTCTCATAAGGG + Intergenic
1170546543 20:17439770-17439792 TTGGCCACCCACTGCGCTGAAGG - Intronic
1170681140 20:18526701-18526723 AAGGCCACCCACTCTAATTAAGG - Intronic
1175796449 20:61774217-61774239 TTGGCCACCCATGCCCCTTGAGG + Intronic
1178516724 21:33254216-33254238 TGGACCACTCACTCCCATCATGG - Intronic
1178676485 21:34635579-34635601 CTGTCCTCCCACTCCCATTGAGG + Intergenic
1182351573 22:29702884-29702906 TGGGCCAGTCACTCCCATTTTGG - Intergenic
951931097 3:27968122-27968144 TTGGCCTCCCAGTTCCTTTAGGG + Intergenic
953048402 3:39316495-39316517 CTGACCACCCATTCCCATCATGG - Intergenic
955084586 3:55690397-55690419 TTGGCCACCCCCTCTCAATGGGG + Intronic
960035095 3:113094269-113094291 TTGGTCACAGACTCCCAGTAGGG - Intergenic
961003698 3:123390749-123390771 TAGGCCACCCAGTCCCATCCTGG + Intronic
962315293 3:134355564-134355586 TTGGACACCCACTCCCACTGTGG + Intergenic
970159776 4:13176852-13176874 TTAGCCACCCGATCCCATGAAGG - Intergenic
971041868 4:22762799-22762821 TTGGCCTCACTCTCCCTTTAAGG - Intergenic
971601438 4:28596412-28596434 TTGGCCACCTTCTCCCATTTGGG + Intergenic
974488114 4:62529912-62529934 TTGACCACCCATTCCCATCATGG + Intergenic
974914842 4:68167069-68167091 TTGGCCAGCCAGTTCCATTGAGG + Intergenic
976008744 4:80461597-80461619 CTGAGCACCCATTCCCATTATGG + Intronic
978138299 4:105289669-105289691 TTGTCCACCCATGCCCATCATGG - Intergenic
979400822 4:120247229-120247251 TGGCCCACCCACCCCCATTCTGG - Intergenic
981840941 4:149111180-149111202 TTGCCCTCCCCCTCCCATTTTGG + Intergenic
983468359 4:168123985-168124007 TTGCACAGCCACTCCCATTCAGG + Intronic
988178323 5:27756570-27756592 TTGACCCCGCAATCCCATTACGG + Intergenic
991247179 5:64520750-64520772 TTGGCCACCTGCTCCCCTTCAGG + Intronic
995941619 5:117592690-117592712 TTGGCCCAGCAATCCCATTACGG + Intergenic
997606438 5:135178537-135178559 TTGGCCACCCACGGCCCTTAGGG + Intronic
999783843 5:154873440-154873462 TAGGCCACCTACTGACATTATGG + Intronic
1003787076 6:9498470-9498492 CTGGCCACCCATTCTCATCATGG + Intergenic
1003907904 6:10719674-10719696 CTGGCCACCCACAGCCAGTAGGG - Intergenic
1007721285 6:43886927-43886949 GAGGCCACTTACTCCCATTAGGG - Intergenic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1013982196 6:116144725-116144747 TATCCCACCCACTCCCCTTAGGG - Intronic
1015488067 6:133794306-133794328 TTGGCCCAGCAATCCCATTATGG - Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1018489785 6:164280037-164280059 TTGGCCAACCTCTCCCATTTGGG + Intergenic
1019414043 7:919307-919329 GTGGCCACGCACTTCCATTCGGG - Intronic
1020101002 7:5394439-5394461 TGGGCCGCCCACGCCCATGAAGG - Exonic
1026536417 7:71242212-71242234 TTGGCCCACCTCTGCCATTAGGG + Intronic
1030703760 7:112669411-112669433 AAGGACACCCTCTCCCATTATGG - Intergenic
1033318161 7:140315695-140315717 CGGGCCACCCCCTCCCATCATGG + Intronic
1035270920 7:157719377-157719399 TTGGCCTTCCACTCCCAATGGGG - Intronic
1043917805 8:85943554-85943576 TTGGTCTTCCACTCCCATTTGGG - Intergenic
1047582638 8:126233315-126233337 TTGCCCACCCACGCACATTCAGG - Intergenic
1049529773 8:143148396-143148418 ATGGGCACCCACCCCCATCATGG + Intergenic
1054847086 9:69809102-69809124 TGGGCCACCCAAACCCATAACGG - Intergenic
1055765370 9:79657445-79657467 TTGCCCACCCCCTCTCATTGAGG + Intronic
1060208484 9:121696564-121696586 TTGGCCCTCCACCCCCATGAAGG + Intronic
1062378296 9:136274841-136274863 CTGGCCACCCCCTCCCAATGTGG - Intergenic
1185956459 X:4496150-4496172 TTGGCCACACAGTCACATTATGG - Intergenic
1187573779 X:20532543-20532565 TTCTCCACCCACTCCCATGCCGG - Intergenic
1192732011 X:73809842-73809864 CTGACCACCCACTTCCATCATGG - Intergenic
1194032661 X:88835759-88835781 TTGGCCAACTTCTCCCATTAGGG - Intergenic
1194212121 X:91082259-91082281 TTTGGCACCCACTCCAATTTTGG + Intergenic
1195613945 X:106897985-106898007 CTGGCCCCCCCCCCCCATTATGG + Intronic