ID: 1166228932

View in Genome Browser
Species Human (GRCh38)
Location 19:41414300-41414322
Sequence CAGGGTTAGGACTCTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166228923_1166228932 -2 Left 1166228923 19:41414279-41414301 CCAAGCAAGAAAGAGACAAGCCA 0: 1
1: 0
2: 1
3: 26
4: 328
Right 1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG 0: 1
1: 0
2: 3
3: 19
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166228932 Original CRISPR CAGGGTTAGGACTCTGGAGG GGG Intronic
900714193 1:4133523-4133545 CTGGGGGAGGACTCTGCAGGCGG - Intergenic
900746748 1:4365936-4365958 CAATGTGAGGCCTCTGGAGGTGG + Intergenic
901786363 1:11627463-11627485 CAGGGTTAGGTCTCTGAACTTGG - Intergenic
902147974 1:14419732-14419754 GAGCGTTAGGACTCTTAAGGCGG + Intergenic
902152474 1:14454877-14454899 GAGGGTTAGGAATCTGGGTGTGG + Intergenic
902202949 1:14847487-14847509 CAAGGATTGGACTATGGAGGTGG - Intronic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
903053688 1:20620264-20620286 CAGGGTGGGTGCTCTGGAGGGGG + Intergenic
903141036 1:21339336-21339358 CAGGGATAGGACTGTTGAGCCGG - Intronic
904080475 1:27869355-27869377 CAGCTTTTGGACTCTGAAGGTGG - Intergenic
905313634 1:37067504-37067526 CAGTGTCAGGACTGTGAAGGTGG - Intergenic
908163369 1:61433981-61434003 CAGGGTTAGGATTTTGCAGTGGG - Intronic
908752700 1:67439813-67439835 GAGGTTTAGGAATCAGGAGGAGG - Intergenic
909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG + Intergenic
909844329 1:80372640-80372662 CAGGGGTAAGACTCTGGTGGAGG - Intergenic
910105945 1:83631277-83631299 CAGGGATAGGACAATGGGGGTGG - Intergenic
910353230 1:86324017-86324039 GAGGGTTAGGAATCTGAAAGGGG + Intergenic
914751597 1:150538446-150538468 CCGGGATAGCACCCTGGAGGGGG + Intergenic
915283314 1:154837500-154837522 CAGGGTGAGGAACCAGGAGGAGG - Intronic
915941914 1:160123693-160123715 CAGGGTTAGGACTTTGCTAGGGG - Intronic
918577851 1:186085333-186085355 CAGGGTTTGGTGTCTGGAGAAGG + Intronic
920159838 1:203988106-203988128 CAGGGTGAGGACGTGGGAGGAGG + Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922415098 1:225414178-225414200 CAGGGGTCAGACTCTGGAGCTGG + Intronic
922677304 1:227560857-227560879 CAGGCTTCGGGCTCTCGAGGTGG - Intergenic
924859629 1:247907782-247907804 GATGGTTAATACTCTGGAGGTGG + Intergenic
1062824572 10:558302-558324 CAGGGTCAGGAAGCGGGAGGTGG - Intronic
1063368282 10:5504658-5504680 CAGGGTGAGGACTCGGAAGGTGG + Intergenic
1066295067 10:34046949-34046971 CAGGTCTAAGACTCTGGTGGAGG - Intergenic
1068169590 10:53376067-53376089 CAGGGTTGGGAGGCCGGAGGAGG + Intergenic
1069069096 10:63975761-63975783 CAGGGCTAGCATTCTGGTGGGGG - Intergenic
1069536406 10:69256885-69256907 CAGGGTTAGGGTTGTGGAGGTGG + Intronic
1069613059 10:69788160-69788182 CATGGCTTGGACTCTTGAGGAGG - Intergenic
1070337710 10:75469933-75469955 CAGGGTTAGTGCCCTGCAGGTGG - Intronic
1071226499 10:83536173-83536195 CAGTGTTAGGAATCAGAAGGTGG + Intergenic
1071289272 10:84176884-84176906 CTGGCTGAGGACTGTGGAGGTGG + Intronic
1071450075 10:85785747-85785769 CAGGTTTGGGAGTCTGGGGGTGG - Intronic
1074003116 10:109392239-109392261 CAGGGTAAGGACGCTGGTGCTGG + Intergenic
1074321833 10:112410574-112410596 CTGGGCTAGGAGGCTGGAGGAGG - Exonic
1075216618 10:120542065-120542087 TTGAGTTAGGCCTCTGGAGGTGG + Intronic
1076795466 10:132795859-132795881 CAGGGAGAGGACACAGGAGGAGG + Intergenic
1077342304 11:2031521-2031543 CTGGGTTGGGAGTTTGGAGGGGG + Intergenic
1080825629 11:35846605-35846627 CAGGGTTGGGACACTGGAGGTGG - Intergenic
1082808004 11:57462079-57462101 GAGGGTGAGGACTTTGGAAGGGG + Intronic
1083366790 11:62146202-62146224 CAGTCTTAGGACTCTAGAGAAGG + Intronic
1084106513 11:66984225-66984247 CAGGGTGAGGTGACTGGAGGAGG + Intergenic
1084122371 11:67077280-67077302 CAGGGTGAGGAGGATGGAGGAGG - Intergenic
1086392136 11:86375695-86375717 CAGGGTAAGTACTTTGGAAGGGG + Intronic
1088728302 11:112658695-112658717 CCGGGTGAGAAGTCTGGAGGAGG - Intergenic
1089228679 11:116949918-116949940 CAGAGTTAGGGCTCTGGAGCTGG + Intronic
1202825290 11_KI270721v1_random:86710-86732 CTGGGTTGGGAGTTTGGAGGGGG + Intergenic
1091688473 12:2580080-2580102 CAGAGTTGGGAAGCTGGAGGGGG + Intronic
1092290611 12:7157743-7157765 CACGGTGAGGACTCCTGAGGAGG + Intronic
1092501576 12:9052674-9052696 AAGGGTATGGACTCTGGAGCTGG + Intergenic
1092508438 12:9127800-9127822 CAAGGTGCGGGCTCTGGAGGAGG + Intergenic
1092794014 12:12092752-12092774 CTGGGTTGTGACTCTGCAGGAGG - Intronic
1093878809 12:24380387-24380409 CAGGCTTATGAATCTGGATGAGG - Intergenic
1095599981 12:44002865-44002887 CAGGGACAGGACTTTGTAGGTGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097033065 12:56103770-56103792 CAGTGTTTGGCCTCTGAAGGAGG - Intronic
1097145902 12:56939214-56939236 CAGGGCCAGGCCTGTGGAGGAGG - Intergenic
1097151463 12:56982752-56982774 CAGGGCCAGGCCTGTGGAGGAGG - Intergenic
1098918678 12:76283011-76283033 CAGGGTTAGGACTCAGGCCAAGG - Intergenic
1101168278 12:102061814-102061836 CAGGGTGGGGACTCGGAAGGTGG + Intronic
1101562841 12:105875526-105875548 CATGGTTGGGACTCTGGAGTCGG + Intergenic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1102968818 12:117149696-117149718 CAGGGCTGGGTCTCTGGAGCAGG - Intronic
1107873425 13:44767923-44767945 AAGAGTTTGGATTCTGGAGGGGG + Intergenic
1107979507 13:45720992-45721014 CAGGGTCAGGCTTCTGGAGATGG + Intergenic
1108239454 13:48446896-48446918 CAGGGTTTTGAGTGTGGAGGTGG + Intronic
1110918016 13:81047445-81047467 CAAGATTAGCACTTTGGAGGTGG - Intergenic
1112708413 13:102099045-102099067 GAGGGGCAGGGCTCTGGAGGGGG + Intronic
1113519633 13:110930578-110930600 AAGGTGTAAGACTCTGGAGGTGG - Intergenic
1115258400 14:31427184-31427206 CAGAGCTAGGACTGAGGAGGAGG + Intronic
1116769491 14:49110750-49110772 CAGGGTTTGAATTCTGGAGTAGG + Intergenic
1118974445 14:70664881-70664903 CAGGGTTCAGACTTTGGGGGAGG - Intronic
1119169952 14:72527244-72527266 CAGATTTAGGACTCAAGAGGAGG + Intronic
1120356660 14:83442805-83442827 CAGGGTTAGGACTCTGAAGAAGG + Intergenic
1121708221 14:96017174-96017196 CAAGGTGAGGATGCTGGAGGAGG - Intergenic
1122307610 14:100775803-100775825 CAGGGTCAAGACCCTGGAGCTGG + Intergenic
1125288153 15:38116543-38116565 CAGAGTTAGGATTTTGGAAGAGG - Intergenic
1125331972 15:38591480-38591502 CAGGGTTAGGGTTTTGGAGTGGG - Intergenic
1129671620 15:77610911-77610933 CAGGGCTGGGACGATGGAGGGGG + Intergenic
1129671639 15:77610965-77610987 CAGGGCTGGGACGATGGAGGGGG + Intergenic
1129671659 15:77611019-77611041 CAGGGCTGGGACGATGGAGGGGG + Intergenic
1129819067 15:78584133-78584155 AAGGGTGAGGGCTCTGGAGATGG + Intronic
1130150340 15:81306799-81306821 CAGGGCCAGGACTCTAGAGTGGG + Intronic
1130372776 15:83300436-83300458 CAGAATTAGGGGTCTGGAGGGGG - Intergenic
1130997566 15:88912472-88912494 CAGGGCCAGGACTCTTTAGGTGG - Intronic
1132113838 15:99121258-99121280 CAGGGCCAGCACTGTGGAGGGGG + Intronic
1134563553 16:15231419-15231441 CATGGTGTGAACTCTGGAGGCGG + Intergenic
1134829838 16:17314008-17314030 GAGGGTCAGGACACTGGAGAGGG + Intronic
1135265518 16:21022266-21022288 CAGTCTTAGGACCCTGAAGGAGG - Intronic
1135984548 16:27174456-27174478 CAGGGTCTGGAATCTGGGGGAGG - Intergenic
1137512490 16:49113948-49113970 AAGGGTCAGGAATCTGGAAGTGG + Intergenic
1137830642 16:51539915-51539937 CGGGGGCAGGACTCTGGTGGGGG + Intergenic
1139683024 16:68580368-68580390 CAGGGATTGGACTCTGGGGTGGG + Intergenic
1139891464 16:70255575-70255597 CAGGGGTAGGACACTGGGGCAGG + Intronic
1140859050 16:79003498-79003520 CTGGGTCAGGACTCTGGATAGGG + Intronic
1141026110 16:80550224-80550246 CAGGGTGAGGACACTGGTGTAGG - Intronic
1141252711 16:82372836-82372858 AAGGGTTAGGAGTCTGGATTAGG + Intergenic
1141961013 16:87409109-87409131 AAGTGGTAGGACTCTGGAAGAGG - Exonic
1145976873 17:28988868-28988890 CAGGGTTGGGACTCAGGATGGGG + Intronic
1146682315 17:34816988-34817010 CAGGGTGGGGACTCTGCAGATGG + Intergenic
1146713556 17:35063944-35063966 TTGGGTAAGGGCTCTGGAGGTGG - Intronic
1146941214 17:36845597-36845619 GGTGGTTAGGACTCTGGAGGCGG + Intergenic
1147326867 17:39673835-39673857 CTGGGTGAGGACTCTGGGGTAGG - Intronic
1148183519 17:45624298-45624320 CAGGGTTAGGGCTAAGGAGTGGG + Intergenic
1148265332 17:46221393-46221415 CAGGGTTAGGGCTAAGGAGTGGG - Intronic
1149523547 17:57336855-57336877 GAGGGTCAGGAATCTGGAGTGGG + Intronic
1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG + Intronic
1150074668 17:62182286-62182308 AATGGTTTGAACTCTGGAGGTGG - Intergenic
1150131312 17:62670705-62670727 CAGGGTTAGGAGTTAGGAGCGGG + Intronic
1150448021 17:65242774-65242796 CAGGGTTAGGAGTTTGCAGGAGG - Intergenic
1151235225 17:72715080-72715102 CAGGGTCTGCACTCAGGAGGAGG + Intronic
1151555035 17:74842554-74842576 CAGGGGCAGGACTCTGGGGCTGG - Exonic
1151585230 17:75004615-75004637 CCTGGTCAGGACCCTGGAGGTGG - Exonic
1151704513 17:75759575-75759597 CTAGGGCAGGACTCTGGAGGAGG + Intronic
1151959212 17:77396630-77396652 CAGTCTTAGGACTCTGATGGGGG + Intronic
1152133428 17:78490836-78490858 CAGGGTGAGGACCTAGGAGGGGG + Exonic
1153656521 18:7287643-7287665 CAGGCTTAAGGGTCTGGAGGAGG - Intergenic
1154411529 18:14144545-14144567 CAAGGCTAGGCCTCTGCAGGAGG + Intergenic
1155802356 18:30123595-30123617 CAGGGTTAGGAATCTGCAAAAGG - Intergenic
1156484498 18:37456284-37456306 CTTGGTAAGGACTCTGGAAGTGG + Intronic
1157509742 18:48262359-48262381 CAGGGTGTGGACTCTGTAAGTGG - Intronic
1157522142 18:48352596-48352618 CAGGGTGAGCAGGCTGGAGGAGG + Intronic
1158143252 18:54280227-54280249 CAAGGTTAGGCCTCTGGTGAGGG + Intronic
1158510516 18:58086367-58086389 CAGGGTGGGGGCTCTGGATGTGG + Intronic
1158519500 18:58159425-58159447 CAGGGATACTACTCTGGAGCAGG + Intronic
1162068140 19:8138018-8138040 GAGGGTTAGGGCTTTGGAGGGGG - Intronic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1163092860 19:15033350-15033372 CATGGTTATGCCTCTGGAGGTGG - Intergenic
1163127119 19:15250302-15250324 AATGGTGAGGACCCTGGAGGTGG - Intronic
1163560091 19:18013976-18013998 CAGGGCTGGGACTCTGCAGTTGG - Exonic
1164741154 19:30576406-30576428 CAGGGGTGGGGCTCTGGAGAAGG - Intronic
1165727343 19:38122442-38122464 CAGGGTGAGGGCTCTGGGAGAGG - Intronic
1166007329 19:39916522-39916544 GAGGGTGAGGACCCGGGAGGAGG - Intronic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
1167245026 19:48367976-48367998 CTGGATTAGCACTCTGGGGGTGG - Intronic
1167470556 19:49673461-49673483 GAGGGTCAGGACACTGGAGTGGG - Intronic
1167491024 19:49792699-49792721 GAGGGTTGGGACTGTGGGGGTGG - Intronic
1168269252 19:55240868-55240890 GAGGGGTAGGCCTCTGGAGAGGG + Intronic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
926692316 2:15746042-15746064 CAGGGGCAGGACACTCGAGGTGG - Intergenic
927519572 2:23690678-23690700 CCGCGTTAGGAGTCCGGAGGCGG - Intronic
929662596 2:43803510-43803532 CAGGGATAGAACTATGGATGGGG + Intronic
929826559 2:45313451-45313473 AAGGGTTAGGATTTGGGAGGAGG + Intergenic
929933729 2:46277938-46277960 ATGGATTAGGACTGTGGAGGTGG - Intergenic
932700133 2:73985989-73986011 CAGGGTCTGGACGCTGGAGAAGG - Intergenic
933741114 2:85534567-85534589 GAGTGTTAGGACTCAGGAGCAGG - Intergenic
934088556 2:88530703-88530725 CAGGGTTTGGTCTCTGGTGGGGG - Intergenic
934810051 2:97270014-97270036 CAGCCTGAGGACACTGGAGGAGG - Intergenic
934827641 2:97437925-97437947 CAGCCTGAGGACACTGGAGGAGG + Intergenic
936493969 2:113001634-113001656 CAGGGTTGGGGCTGGGGAGGTGG - Intergenic
936610504 2:113997648-113997670 CTGAGTCAGGACTCTGGAGCTGG + Intergenic
937418345 2:121735265-121735287 AAAGGTGAGGACTCTGGAGTTGG - Intronic
938104711 2:128521875-128521897 CAGGGTAAGGACTCCAGGGGTGG + Intergenic
939353655 2:141072699-141072721 AAGGGTTAGGACAATGGAGAAGG - Intronic
940855328 2:158724743-158724765 CAGGGAAGGGACCCTGGAGGGGG + Intergenic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
943201726 2:184835542-184835564 CAGGGCTTGGACTCTGGACCAGG - Intronic
945994151 2:216421877-216421899 CAGGGTTTGGGTTCCGGAGGAGG + Intronic
946894929 2:224313956-224313978 CAGGATCAGGACTCTGGGGAAGG - Intergenic
1171461572 20:25300935-25300957 CAGTGTGAGGACTGTGGAGAAGG - Intronic
1171474043 20:25393887-25393909 CAGGGTGGGGACCATGGAGGCGG - Intergenic
1171970402 20:31561496-31561518 CTGGGCTGGGAGTCTGGAGGTGG - Intronic
1172532440 20:35642247-35642269 CTGGGTTAGGACTTTGGAAGTGG - Intronic
1173594800 20:44251726-44251748 CAAGGTTAGGACCCTGCAGGAGG - Intronic
1175138361 20:56841731-56841753 CAGGGACAGGCGTCTGGAGGAGG + Intergenic
1176861528 21:14013879-14013901 CAAGGCTAGGCCTCTGCAGGAGG - Intergenic
1178842153 21:36146395-36146417 CAGCATCAGGACTGTGGAGGAGG + Exonic
1178968426 21:37147064-37147086 GAGTGTTAGGATTCTGGATGAGG + Intronic
1181618304 22:24070419-24070441 CAGTGCCAGGGCTCTGGAGGGGG - Intronic
1183106188 22:35616985-35617007 CAGGGATTGGACTCAGGAGAGGG - Intronic
1183160567 22:36110426-36110448 GGGGGTTGGGACCCTGGAGGAGG + Intergenic
1183208264 22:36433878-36433900 CGGAGTTAGGAATCTGGAGATGG - Intergenic
1184121562 22:42453879-42453901 CAATGTTAAGAGTCTGGAGGAGG + Intergenic
1184127916 22:42500771-42500793 CCTGGTTGGGACTGTGGAGGAGG + Intergenic
1184149670 22:42630850-42630872 CTGGGTCATGACTGTGGAGGGGG - Intronic
949579338 3:5371619-5371641 AAGGGTTAGGAGGCTGGTGGAGG - Intergenic
951697517 3:25461255-25461277 CAGGGTTTGTACACTCGAGGGGG - Exonic
951829610 3:26911367-26911389 CAAGGTGAGGACTCAGAAGGAGG + Intergenic
953502934 3:43455350-43455372 CAGAGGTATGACTGTGGAGGTGG + Intronic
954117959 3:48477748-48477770 CAGGGGCTGGACACTGGAGGAGG - Intronic
954263367 3:49455836-49455858 CAGGGTAAGGAATTGGGAGGAGG - Intergenic
954391135 3:50268694-50268716 GGGGGTCAGGCCTCTGGAGGTGG - Intronic
954689005 3:52385986-52386008 CATGGTGAGCACTCAGGAGGTGG + Intronic
955948994 3:64223381-64223403 CAGGGCTCAGACTCTGGAGCTGG - Intronic
956061201 3:65349791-65349813 CAGGGAGAGGAATCTGTAGGTGG + Intergenic
958674116 3:97244095-97244117 CAGTGTGAGGACTGTGGTGGAGG + Exonic
959867097 3:111283341-111283363 AGGGGGTGGGACTCTGGAGGTGG + Intergenic
960948670 3:122984213-122984235 CAGGGATTGGAAGCTGGAGGCGG + Intronic
961103016 3:124217942-124217964 CATGGTGAGGACACTGGAGCAGG + Intronic
961235439 3:125362522-125362544 AAGGGTAAGGACTTTGGTGGGGG - Intronic
961513906 3:127421027-127421049 CAGGGTGAGTACTCTGTTGGAGG - Intergenic
963025018 3:140911004-140911026 CGGGGTGAGGACTCTTGAGGAGG - Intergenic
964419715 3:156488696-156488718 AATGCTTAGGACTCTGGAGTTGG - Intronic
964463075 3:156958487-156958509 CAGGCTTGGGGCACTGGAGGTGG - Intronic
966863071 3:184241401-184241423 CTTGGTGAGGACTCGGGAGGTGG + Exonic
968229251 3:196995633-196995655 CTGGGCTTGGAGTCTGGAGGAGG + Intronic
969837126 4:9850974-9850996 CAGGGGTGGGACACTGGTGGGGG - Intronic
970180217 4:13384082-13384104 CAGGGGTGAGGCTCTGGAGGTGG - Intronic
971495950 4:27265401-27265423 AAGGGTCAGGAATCTGGAAGTGG - Intergenic
971642882 4:29158188-29158210 CAGGATTAGGATTATGGAAGGGG - Intergenic
972566809 4:40276829-40276851 CAGTGTTAGCACCCAGGAGGAGG + Intergenic
972900487 4:43675858-43675880 GTGGGTCAGGAATCTGGAGGTGG - Intergenic
974555645 4:63444431-63444453 CAGGGCTGGGACTCTGGATCAGG - Intergenic
975840296 4:78466439-78466461 AGGGGTGAGGACACTGGAGGAGG + Intronic
977381261 4:96277201-96277223 GAGGGTTTGGACTTGGGAGGAGG + Intergenic
977891707 4:102319619-102319641 CAGGGGTAGGAGTGGGGAGGGGG - Intronic
979292946 4:118998038-118998060 CAGTGTTAGGATTCTGACGGGGG + Intronic
981891720 4:149746186-149746208 CAGGGTTAGGAGGATTGAGGTGG - Intergenic
981893329 4:149765608-149765630 CAGGGTTAGGATTATGGGAGGGG + Intergenic
982133977 4:152256576-152256598 CAGGGGCAGGACTCTGGGAGGGG - Intergenic
983943495 4:173561147-173561169 AAGGGTTAGCAGTCTGGAGATGG + Intergenic
986686103 5:10276337-10276359 CAGGGTTAGCACTCCTGGGGAGG + Intronic
986691226 5:10315545-10315567 GAGGGTCAGGAATCTGGGGGTGG - Intergenic
990489384 5:56289201-56289223 TAGGGTAAGAACTCTGGAGTAGG - Intergenic
992985972 5:82230051-82230073 AAGGGTTAGGGCTCGGGATGGGG - Intronic
993875374 5:93300290-93300312 CAGTTTTTGCACTCTGGAGGTGG + Intergenic
996602361 5:125279115-125279137 CAGGCTTAGAACTCTGTAGCTGG + Intergenic
998394538 5:141810164-141810186 CATGTTTAGTCCTCTGGAGGTGG + Intergenic
1003760357 6:9172729-9172751 CAGGCTAAGGACTCTGGGAGTGG + Intergenic
1004979593 6:21008398-21008420 CAGGGTCAGGCCCGTGGAGGTGG + Intronic
1006515549 6:34543815-34543837 CATGGTTGGGACACTAGAGGTGG + Intronic
1006824571 6:36925212-36925234 CAGGGTAAGGACACTGCAGAAGG - Intronic
1006838041 6:37011068-37011090 CAGGGCTGGGGCTCTAGAGGGGG - Intronic
1006971807 6:38053209-38053231 CATGGTTAGGATTCTGGATCTGG + Intronic
1007124825 6:39417171-39417193 CCAGGTTAGGACTAAGGAGGAGG - Intronic
1007373505 6:41441994-41442016 CAGGGTGAGAAGCCTGGAGGTGG + Intergenic
1010378454 6:75201957-75201979 CAAGGGCAGGACACTGGAGGTGG + Intronic
1013296767 6:108764631-108764653 CAGTCATAGGATTCTGGAGGAGG + Intergenic
1013818232 6:114124256-114124278 CTGGGTTGGGACTCAGGAGCTGG - Intronic
1015342972 6:132123211-132123233 CAGTGTTTGGAGTCTGGAGTGGG + Intergenic
1017953790 6:159161121-159161143 CAGTGTTAGGAAGCTGGAAGTGG - Intergenic
1019487298 7:1295251-1295273 CAGGGGTGGGTCTATGGAGGGGG + Intergenic
1020008015 7:4792458-4792480 CAGCCTCAGGACTATGGAGGGGG + Intronic
1024001771 7:45194626-45194648 GAGGGTTAAGACTTTGAAGGAGG + Intergenic
1025614942 7:63110305-63110327 CAGTGTTAGGAGTCAGGATGAGG + Intergenic
1027138088 7:75638871-75638893 CCGGGCCAGGATTCTGGAGGCGG - Intronic
1028723883 7:94065198-94065220 AAGCGTTATGACTATGGAGGAGG - Intergenic
1029800439 7:102941312-102941334 CAGGGTAAAGAATCTGGAAGTGG + Intronic
1033304992 7:140218687-140218709 CAGAGATAGGACTCTGGGGTGGG + Intergenic
1036527819 8:9551504-9551526 CATGGTTATGACTTTGGGGGAGG + Intergenic
1037789434 8:21923972-21923994 CAGGGTTAGGAATCTGGGAGTGG + Intronic
1038043371 8:23745809-23745831 CAAGGGTTGAACTCTGGAGGCGG + Intergenic
1038122316 8:24631287-24631309 CAGACCTAGGACTGTGGAGGAGG - Intergenic
1038503838 8:28067526-28067548 GAGGGTGATGACTCTGGAGGTGG + Exonic
1040652142 8:49461012-49461034 CAGGCTTGGCACTCTGGGGGTGG - Intergenic
1042965814 8:74350679-74350701 CGGGGTCAGGACACTGGAGGCGG - Intronic
1044289289 8:90448511-90448533 AAGGGAGAGGAATCTGGAGGAGG - Intergenic
1045766480 8:105677410-105677432 AAGAGTGTGGACTCTGGAGGTGG - Intronic
1046065641 8:109193924-109193946 CAGGGTTTGGACACTGGAGGAGG - Intergenic
1051288673 9:15523326-15523348 AAGGGTTAGGAATTGGGAGGAGG - Intergenic
1051328916 9:16003163-16003185 CAGGACTAGAACTCTGGATGTGG - Intronic
1052277336 9:26692045-26692067 CAGGGGTTGGAAGCTGGAGGAGG + Intergenic
1056260373 9:84842515-84842537 CAGGGTTGGGACTCTGGCCGTGG + Intronic
1056559699 9:87719312-87719334 CAGGATTTGGTCTCAGGAGGTGG - Intergenic
1056566419 9:87776762-87776784 CAGGATTTGGTCTCAGGAGGTGG + Intergenic
1057354964 9:94325260-94325282 CAGTGTCAGGACTCTGGGGAAGG + Exonic
1057652788 9:96932374-96932396 CAGTGTCAGGACTCTGGGGAAGG - Exonic
1057696647 9:97327761-97327783 CAGAGTTAGGACCCTGGACAGGG + Intronic
1058917580 9:109582302-109582324 AAGCGTTTGAACTCTGGAGGCGG + Intergenic
1059539795 9:115118684-115118706 CAGGATTAGGTCTCAGCAGGTGG + Intergenic
1059822342 9:117987076-117987098 CAGGGTTTGTACTCTGGTGTTGG - Intergenic
1062053473 9:134458863-134458885 CAGGGTGAGGGCTCTGGGTGAGG + Intergenic
1062676404 9:137747829-137747851 CACGGTTAGCACTCAGGAGAGGG - Intronic
1186609793 X:11127890-11127912 CAGGGTTTTAAATCTGGAGGTGG + Intergenic
1188440958 X:30215185-30215207 CAAGGTGAGGACTCTGAGGGCGG + Intergenic
1190327360 X:49215044-49215066 TAGGGTCAGGAGTCTGGCGGGGG + Intronic
1193649241 X:84109679-84109701 CAGGGAGAGTACTCTGGAAGTGG - Intronic
1195546842 X:106122840-106122862 AAGTGCTAGGTCTCTGGAGGGGG - Intergenic
1198991206 X:142516512-142516534 CAGGGTGAGGAGACTGAAGGTGG - Intergenic
1199000697 X:142632846-142632868 CAGGGGCAGGACACTGGCGGGGG + Intergenic
1201550768 Y:15214329-15214351 CAGTGTTAGGACACTGAGGGAGG + Intergenic