ID: 1166231502

View in Genome Browser
Species Human (GRCh38)
Location 19:41427698-41427720
Sequence TAGAGTGACCAGGGCGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166231498_1166231502 -6 Left 1166231498 19:41427681-41427703 CCTGGGCTGGGGAGTGTTAGAGT 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1166231502 19:41427698-41427720 TAGAGTGACCAGGGCGAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 178
1166231490_1166231502 21 Left 1166231490 19:41427654-41427676 CCAGGGAGGGTGGGGCTGAAGGC 0: 1
1: 1
2: 2
3: 80
4: 995
Right 1166231502 19:41427698-41427720 TAGAGTGACCAGGGCGAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166231502 Original CRISPR TAGAGTGACCAGGGCGAGGC AGG Intronic
900883879 1:5401923-5401945 TAGAGTGAGGACGGGGAGGCGGG - Intergenic
900924109 1:5692320-5692342 CCGAGTGCCCAGGGCCAGGCAGG + Intergenic
901639374 1:10685748-10685770 TGGAGTGGACAGGGGGAGGCTGG - Intronic
902369558 1:15997331-15997353 GACAGTGGCCAGGGTGAGGCTGG - Intergenic
903336690 1:22629141-22629163 GAGAGTGGCCAGGGAGAGCCTGG - Intergenic
903384653 1:22918448-22918470 TAGGGTGACCAGGGCAGGGATGG - Intergenic
904690038 1:32286972-32286994 CAGAGGGAACAGGGTGAGGCAGG + Intergenic
905646312 1:39626955-39626977 AAGAAAGACCAGGGCCAGGCAGG + Exonic
905789884 1:40784181-40784203 CAGAGCGAACAGGGCGAGGCGGG + Exonic
908031886 1:60009347-60009369 TAGAGTGTTCAGGGAGAGTCTGG + Intronic
917082191 1:171267794-171267816 TACAGAGCCCAGGGCTAGGCTGG - Intronic
918041760 1:180917947-180917969 TAGAGGGACCATGGTGAGGAGGG - Intronic
918139585 1:181709265-181709287 AAGAGTGACCAGGGCCAGTGAGG - Intronic
918538381 1:185601005-185601027 TAGATTGTCCAGGGCTAGTCTGG - Intergenic
922551217 1:226495866-226495888 CCCAGTGACCAGGGCGGGGCAGG + Intergenic
924536161 1:244937487-244937509 TAGGGTGACCAGTGGGAAGCTGG - Intergenic
1063924373 10:10962824-10962846 TTGAGTGACCACTGGGAGGCTGG - Intergenic
1064128043 10:12681351-12681373 GAGAGTGATCATGGGGAGGCTGG - Intronic
1070540534 10:77412355-77412377 TGGAGTGGCCAGGGAGAGGGTGG - Intronic
1072196402 10:93120322-93120344 TAGAAGGACAAGGGCAAGGCTGG + Intergenic
1072618384 10:97064335-97064357 TAAAGTGACCAGCACGGGGCTGG + Intronic
1072929868 10:99652741-99652763 CAGAGAGACCAGGGTGAGGTAGG - Intergenic
1073036104 10:100565173-100565195 AAGGGTGGCCAGGGTGAGGCTGG + Intergenic
1073435163 10:103511743-103511765 TAGTGTGATCAGTGCGAGGATGG - Intronic
1076078508 10:127556770-127556792 TGGAGTGAGCAGGGTGAGGGTGG + Intergenic
1077043309 11:534005-534027 GAGAGGTACCAGGGAGAGGCTGG - Intronic
1078386167 11:10894855-10894877 TAGTGAGACCAGTGGGAGGCTGG - Intergenic
1080387722 11:31819555-31819577 TAGAGTGGCCAGTGGGAGGTGGG - Intronic
1082160320 11:48882676-48882698 CAGAGAGACCAGGGGGAGTCTGG - Intergenic
1082162046 11:48897730-48897752 CAGAGAGACCAGGGGGAGTCTGG + Intergenic
1082167629 11:48966175-48966197 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1082239380 11:49855031-49855053 CAGAGAGACCAGGGAGAGTCTGG - Intergenic
1082242767 11:49889321-49889343 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1082657260 11:55870130-55870152 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1083296063 11:61716259-61716281 CAGTGTGACCAGGGCCATGCTGG + Intronic
1083882138 11:65553981-65554003 TAGGGTGGCCAGGGCAGGGCAGG - Intronic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1085304391 11:75476898-75476920 TGGAGTGGCCAGGGGGTGGCAGG - Intronic
1087113638 11:94499187-94499209 TAGGTTGACCAGGGTGAGGTAGG - Exonic
1089220980 11:116871377-116871399 TGGAGTGAACAGGGTGAGGCAGG + Intronic
1098312876 12:69164996-69165018 TTGAGGGATCAGGGCCAGGCTGG + Intergenic
1102542197 12:113629329-113629351 TGGAGTGACCAAGGGGAGGGTGG + Intergenic
1103334412 12:120178525-120178547 TAGGGTCACCAGGGCAAAGCAGG + Intronic
1103710515 12:122909046-122909068 TTGGGAGACCAAGGCGAGGCAGG - Intergenic
1104959101 12:132479779-132479801 TACAGGGCCCAGGGAGAGGCAGG - Intergenic
1112493936 13:99890761-99890783 TAGAGTGACCAGGGACGGCCAGG - Intronic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1120261445 14:82190134-82190156 TAGCGGGACCATGGCCAGGCAGG + Intergenic
1121730803 14:96185717-96185739 CAGAGTGACCTTGGGGAGGCGGG + Intergenic
1122961282 14:105094561-105094583 TGGAGTGAGGAGGGAGAGGCAGG + Intergenic
1125778568 15:42242334-42242356 AAGAGGGACCAGAGCCAGGCTGG + Intronic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1128617432 15:69121168-69121190 TAGAATGACCCGGGGGAGGGAGG + Intergenic
1128762555 15:70227316-70227338 TAGAGGGAGCAGGGCAGGGCTGG - Intergenic
1130383592 15:83392658-83392680 CAGAGTCACCAGGTCAAGGCAGG + Intergenic
1130992931 15:88887309-88887331 CAGGGTGACCCGGGCCAGGCTGG + Exonic
1132086189 15:98910192-98910214 TAGAGTGAGCAGGGGGCGGGAGG - Intronic
1132833001 16:1938623-1938645 TGCAGTGACCAGGGCCAGGGCGG + Exonic
1132893345 16:2215173-2215195 CGGAGTGACCCGGGCCAGGCCGG + Intergenic
1133552288 16:6868417-6868439 TAAAGTTGCCAGGGCGAGGTAGG + Intronic
1137569619 16:49557143-49557165 GAGAGTGACCAGGGCGTGCAGGG + Intronic
1138449067 16:57082294-57082316 TAGAGTTACCTGGCAGAGGCAGG - Intronic
1138472817 16:57251661-57251683 AAGAATGACCAGGGCCAGGCTGG + Intronic
1138652804 16:58471404-58471426 CAGAGTGATCAGAACGAGGCTGG - Intronic
1139590367 16:67929734-67929756 TAGAGTAGCCATGCCGAGGCCGG - Exonic
1141048160 16:80735897-80735919 TAGAGAGAGCAGGGCAAGGCAGG + Intronic
1141428916 16:83960868-83960890 TAGAGGGAGGAGGGAGAGGCAGG - Intronic
1141840732 16:86572609-86572631 TAAAGAGACCAAGGCCAGGCAGG - Intergenic
1141974694 16:87507772-87507794 AAGTGTGACCAGGAGGAGGCTGG + Intergenic
1142234268 16:88914589-88914611 TAAAGCGACCAGGGTGAGTCTGG + Intronic
1143155490 17:4833657-4833679 GACAGGAACCAGGGCGAGGCTGG - Intronic
1143638912 17:8184125-8184147 GAGAGTGGCCAGGCCCAGGCTGG - Intergenic
1144068103 17:11642099-11642121 TGGAGGGGACAGGGCGAGGCAGG + Intronic
1145883409 17:28367515-28367537 AAGAGTGGGCAGGGCCAGGCTGG - Intronic
1146182588 17:30707639-30707661 TAGAGGGAACAGGGGGAGGGGGG - Intergenic
1147462214 17:40580497-40580519 TAGAAGGACCAAGGCCAGGCTGG + Intergenic
1147537697 17:41331714-41331736 GACAGTGGCCAGGGTGAGGCTGG - Intergenic
1147611313 17:41803286-41803308 AAGGGTGACGAGGCCGAGGCTGG - Exonic
1148773383 17:50079558-50079580 GTGAGTGGCCAGGGCGAGGTTGG + Intronic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1150839353 17:68593737-68593759 TAGAGCGACCAGGGCAAGCTGGG + Intronic
1151823322 17:76509075-76509097 TAAAGGGACCAGGGAGAGGGAGG + Intergenic
1151825066 17:76519427-76519449 TAAAGGGACCAGGGAGAGGGAGG - Intergenic
1152584792 17:81184121-81184143 GAGAGTGACCATGGCCAGGGTGG - Intergenic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1153336508 18:3931104-3931126 TAGAGTGAGCCGGTGGAGGCAGG - Intronic
1159884887 18:73894503-73894525 TAGAGTGGGCAGGGCAGGGCAGG - Intergenic
1160809672 19:1007974-1007996 GAGAGGCACCTGGGCGAGGCGGG + Intronic
1161470563 19:4454998-4455020 TGGAGTGGCCAGGGCGAGGCTGG - Intronic
1162489757 19:10985246-10985268 GAGAGGGACCATGGCAAGGCAGG - Intronic
1163019210 19:14473676-14473698 GAGCGCGACCAGGCCGAGGCTGG + Exonic
1163750665 19:19075534-19075556 TAGAGTGAACGTGGCAAGGCTGG + Intronic
1164483998 19:28639130-28639152 TAGAGTGACTGGGGCGGTGCTGG + Intergenic
1164675932 19:30101515-30101537 TAGAGTGACGCAGGCGATGCAGG - Intergenic
1165072828 19:33265436-33265458 TACAGTGGCCAGGGAGAGGAAGG + Intergenic
1165783407 19:38446786-38446808 GGGAGAGACCAGGGAGAGGCTGG + Intronic
1166231502 19:41427698-41427720 TAGAGTGACCAGGGCGAGGCAGG + Intronic
1167009393 19:46796728-46796750 GAGAGAGACCAGGAAGAGGCTGG + Intergenic
1167683584 19:50941455-50941477 TAGAGTGGCCAGCCCCAGGCAGG - Intergenic
1168654687 19:58118456-58118478 TAGTGCGACGAGGGCGGGGCCGG + Intergenic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
925302682 2:2828249-2828271 TTGAGTGACCATAGCGAGGGGGG + Intergenic
926012193 2:9417208-9417230 CAGCGTGGCCTGGGCGAGGCAGG - Intronic
926217027 2:10912149-10912171 GTGAGTGCCCCGGGCGAGGCCGG + Exonic
930882855 2:56291888-56291910 TAGAGAGCCCAGTGGGAGGCTGG + Intronic
931640711 2:64378832-64378854 TGGAGTGATCAGGGCAAGGCAGG - Intergenic
932171042 2:69556686-69556708 GAGAGTGACCAAGGCAAGGGCGG + Intronic
935115745 2:100134903-100134925 TGCAGTGAACAGGGAGAGGCTGG + Intronic
937273393 2:120669575-120669597 TAACGTCACCAGGGCGAGGTGGG - Intergenic
938236238 2:129709176-129709198 TGGAGTCACCAGGGTGAGGGCGG - Intergenic
940778641 2:157910211-157910233 TAGAGTTACATGGGCGAGGTGGG + Intronic
943483621 2:188453946-188453968 TGGAGTGACCAGGTCCAGGCTGG - Intronic
946408040 2:219502596-219502618 GAGATTGACCAGGGGGAGGGGGG + Intronic
946563761 2:220940986-220941008 TAGAGTGACAAGGGTGGGGCAGG + Intergenic
946941276 2:224772420-224772442 TACTCTGACCAGGGCCAGGCAGG - Intronic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
1169082075 20:2803651-2803673 TTGGGAGACCAAGGCGAGGCGGG + Intergenic
1171359012 20:24573573-24573595 CAAAGTGACCAGGGCGCAGCAGG - Intronic
1171849816 20:30300414-30300436 TGGAGAGACCCGGGCGGGGCGGG - Intergenic
1172031497 20:31985181-31985203 CAGAGTGAACAGGGTGGGGCTGG - Intronic
1172556826 20:35849437-35849459 TAGAGCTACCAGGAGGAGGCAGG + Intronic
1174353477 20:49983652-49983674 TTGGGTGACCTGGGCGAGGAGGG + Intronic
1175296168 20:57910187-57910209 TGGTGTCTCCAGGGCGAGGCTGG + Intergenic
1176566630 21:8391711-8391733 ACGAGAGACCACGGCGAGGCGGG - Intergenic
1180534778 22:16387632-16387654 CAGAGTGTCCTGGGGGAGGCAGG + Intergenic
1181335373 22:22124753-22124775 TACACTGCCCAGGGCGGGGCGGG + Intergenic
1182033136 22:27175638-27175660 TAGAGCGAGCAGGGCAAGGTGGG + Intergenic
1185171544 22:49297422-49297444 AAGGGTGACGAGGGCGAGGCGGG + Intergenic
950493049 3:13317865-13317887 GAGAGTGTCCTGGGTGAGGCAGG - Intronic
952157017 3:30654432-30654454 TACAGTGACCAAGGGCAGGCAGG + Intronic
952901073 3:38112085-38112107 TAGCCTGACCAAGGAGAGGCTGG + Intronic
954132355 3:48567135-48567157 AAGGGTGACCAGGGCGAGAAAGG - Exonic
954608937 3:51934130-51934152 TAGGGTGACCTGGGGGAGGGTGG - Intronic
961391213 3:126553248-126553270 TGGGGTGACCTGGGGGAGGCAGG + Intronic
966258581 3:177948690-177948712 TAGAGCTACCAGGACCAGGCAGG + Intergenic
967104120 3:186241926-186241948 CAGAGTGCCCAGGCTGAGGCTGG + Intronic
974074115 4:57153336-57153358 TAGAGTGTCCAGGGCCATGAAGG + Intergenic
979863420 4:125723184-125723206 CAGAGTGTCCAGGCCCAGGCTGG + Intergenic
980859019 4:138476840-138476862 TAAAGTGAACAGGGCAGGGCAGG - Intergenic
982539122 4:156645221-156645243 TAAAGAGACCAGGGTAAGGCCGG - Intergenic
983639670 4:169933409-169933431 TAGAGTGACCTGGGGGAGGATGG + Intergenic
992765300 5:79992936-79992958 TAGACTGACAAAGGCAAGGCAGG + Intronic
997615921 5:135246146-135246168 GAGAGTGAGCAGGGAGGGGCAGG + Intronic
998520172 5:142793164-142793186 TGGAATGACCAGGCTGAGGCTGG + Intronic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
1002134322 5:177098578-177098600 GAGACTGGCCAGGGCGGGGCGGG - Intergenic
1003975988 6:11345098-11345120 AAGAGGGACCGGGGTGAGGCAGG + Intronic
1005688714 6:28281430-28281452 GAGAGTGACCTGGGCGGGGCAGG + Exonic
1006256007 6:32832779-32832801 TGCAGTGGCCAGGGCGGGGCAGG - Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006558626 6:34889709-34889731 TGGCGTGCCCGGGGCGAGGCAGG + Intronic
1007769314 6:44180414-44180436 AAGAGTTACCAGGGGGAGGGAGG - Intronic
1015137517 6:129890571-129890593 CAGAGTGAGCAGGGAGAGCCAGG + Intergenic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1022013712 7:26330452-26330474 GAGAGTTACCAGGGAGGGGCGGG + Intronic
1022197392 7:28082373-28082395 TAGAGTGAACGGGCAGAGGCGGG - Intronic
1025178077 7:56811898-56811920 GAGAGAGACCAGTGTGAGGCAGG + Intergenic
1025178507 7:56813637-56813659 TAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025178927 7:56815331-56815353 TAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025178936 7:56815379-56815401 TAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025179374 7:56817169-56817191 TAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025179832 7:56819055-56819077 TAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025180281 7:56820893-56820915 TAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025180307 7:56821037-56821059 TAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025180752 7:56822875-56822897 TAGAGAGGCCAGTGTGAGGCAGG + Intronic
1025912698 7:65840788-65840810 TAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1026045166 7:66902036-66902058 TAGAGAGGCCAGTGTGAGGCGGG - Intergenic
1029200648 7:98837052-98837074 CAGAGTGACCAGGTGGAGGTTGG - Intergenic
1029568736 7:101357371-101357393 TAGAGTGACCATGGAGAAACAGG - Intergenic
1033269005 7:139913893-139913915 GAGGGTGAGCAGGGAGAGGCTGG - Intronic
1033596739 7:142864456-142864478 GACAGCGACCAGGGCCAGGCAGG - Exonic
1035027536 7:155835872-155835894 GAGGGTGACCTGGGCGTGGCTGG - Intergenic
1037952549 8:23028444-23028466 GAGAGAGAACAGGGAGAGGCAGG + Exonic
1039923753 8:41910827-41910849 TAGGGAGGCCAAGGCGAGGCAGG + Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1048645885 8:136418616-136418638 TTGAGTGAACAGGGAGAGGCTGG - Intergenic
1053070164 9:35096429-35096451 TAGGGTGCCCAGCGGGAGGCTGG - Exonic
1057204661 9:93164091-93164113 CAGAGTGTCCAGGGAGAAGCTGG - Intergenic
1058356902 9:104094015-104094037 TAGAGGGACCGAGGCGGGGCGGG + Intergenic
1058873685 9:109223720-109223742 TAAAGTGCCTAGGGGGAGGCCGG + Intronic
1060763315 9:126274572-126274594 AAGGGTGACCAGGCCGAGACTGG + Intergenic
1061096221 9:128458118-128458140 TGGAGCGACCAGGGGGTGGCAGG - Intronic
1062658327 9:137615372-137615394 GAGGGTGCCCAAGGCGAGGCCGG - Exonic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1190110443 X:47585888-47585910 TAGAGGGACCAGGGAGGGACAGG - Intronic
1199607416 X:149587159-149587181 TGGTGTGACCAGGGCAGGGCTGG - Intronic
1199622417 X:149712790-149712812 TGGTGTGACCAGGGCAGGGCTGG + Intronic
1199628791 X:149762137-149762159 TGGTGTGACCAGGGCAGGGCTGG - Intergenic
1199631707 X:149782208-149782230 TGGTGTGACCAGGGCAGGGCTGG + Intronic
1199897503 X:152138260-152138282 TGGTGTGACCAGGGCCCGGCTGG - Intronic
1199952038 X:152714867-152714889 TTGTGTGACCAGGGCAGGGCTGG + Intronic
1199954677 X:152734044-152734066 TTGTGTGACCAGGGCAGGGCTGG + Intronic
1199957645 X:152753581-152753603 TTGTGTGACCAGGGCAGGGCTGG - Intronic