ID: 1166233786

View in Genome Browser
Species Human (GRCh38)
Location 19:41441600-41441622
Sequence ACTGGGGACCCTTGCCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166233775_1166233786 17 Left 1166233775 19:41441560-41441582 CCTAGCAGGCGAGGGGCTGGTAC No data
Right 1166233786 19:41441600-41441622 ACTGGGGACCCTTGCCTTAGAGG No data
1166233771_1166233786 24 Left 1166233771 19:41441553-41441575 CCCAGTTCCTAGCAGGCGAGGGG No data
Right 1166233786 19:41441600-41441622 ACTGGGGACCCTTGCCTTAGAGG No data
1166233783_1166233786 -10 Left 1166233783 19:41441587-41441609 CCTTGGCCCAGGGACTGGGGACC No data
Right 1166233786 19:41441600-41441622 ACTGGGGACCCTTGCCTTAGAGG No data
1166233773_1166233786 23 Left 1166233773 19:41441554-41441576 CCAGTTCCTAGCAGGCGAGGGGC No data
Right 1166233786 19:41441600-41441622 ACTGGGGACCCTTGCCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166233786 Original CRISPR ACTGGGGACCCTTGCCTTAG AGG Intergenic
No off target data available for this crispr