ID: 1166235958

View in Genome Browser
Species Human (GRCh38)
Location 19:41456805-41456827
Sequence CAGCATCTCGAGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166235954_1166235958 15 Left 1166235954 19:41456767-41456789 CCAGGCGAGAGCTGTTTATTAGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166235958 Original CRISPR CAGCATCTCGAGATGGAGCA GGG Intergenic
901654241 1:10760230-10760252 CAGCCTCTGGAGATGGAGAAAGG + Intronic
904488903 1:30846087-30846109 CAGCACCTGGTGGTGGAGCAAGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
908709739 1:67001776-67001798 CAGCATTGCAAGATGGAGCAGGG - Exonic
912309168 1:108602344-108602366 CAGCACTTCCAGAGGGAGCATGG - Intronic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
913275993 1:117138192-117138214 CAGCATGTAGAGATGGCGGAAGG - Intergenic
914702411 1:150147291-150147313 CAGGATCACAGGATGGAGCAGGG + Intergenic
915137266 1:153741547-153741569 CAGAATCTGGAGATAGAGAAAGG - Intronic
915570111 1:156740749-156740771 CAGCATCTCCAGATTGTGAAGGG - Intronic
916401050 1:164448816-164448838 CAGTATCTCCAGACTGAGCAGGG + Intergenic
916592625 1:166206991-166207013 CACCATCCCGGCATGGAGCATGG + Intergenic
916754146 1:167752591-167752613 CAGCATCTCAATAGGAAGCAGGG + Intronic
918938723 1:190961195-190961217 CAGCCTCTCAAGATTGAGCCAGG + Intergenic
919519635 1:198571878-198571900 CATGAGCTGGAGATGGAGCAGGG + Intergenic
919564864 1:199172068-199172090 CAGCGTATAGAGATAGAGCAAGG + Intergenic
923738094 1:236630933-236630955 CAGCATCTCCAGCTGGAAAAAGG + Intergenic
923774963 1:236969852-236969874 CAGCATCCCTAGGTGGTGCAGGG + Intergenic
1064166858 10:12994105-12994127 CAGCATCTAGAGGTGGGGCATGG + Intronic
1067731363 10:48814042-48814064 CAGCATTTCCAGGAGGAGCAAGG - Exonic
1067756887 10:49012086-49012108 CAGCACCTCGAGGAGTAGCAAGG - Intergenic
1075949016 10:126461467-126461489 CAGCACCCCGCGATGGAGCAGGG - Exonic
1076278813 10:129227858-129227880 CAGCATCTTGAGAGGCAGAAAGG + Intergenic
1078423304 11:11229728-11229750 CAGCCTAATGAGATGGAGCAGGG - Intergenic
1080670187 11:34369276-34369298 AATCATCTCAAGATGGATCAAGG + Intergenic
1081078402 11:38706450-38706472 CAGCATCTCAAGCTAAAGCATGG + Intergenic
1084270157 11:68024986-68025008 CTGCTTCTGGAGTTGGAGCAGGG - Intronic
1085459617 11:76685763-76685785 CAGAAACTCAAGATGGAGGAGGG - Intergenic
1085896383 11:80644540-80644562 CAGCATCCTGAGGTGGCGCAGGG - Intergenic
1087757525 11:102070499-102070521 CAGGAACTCCAGATGGAGAAAGG - Intronic
1090532531 11:127605944-127605966 CAGCATCTCGAAATGGTAAATGG - Intergenic
1094158009 12:27357854-27357876 AATCATCTCAAGATGGATCAAGG + Intronic
1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG + Intergenic
1094435799 12:30419427-30419449 CAGCCTCACATGATGGAGCAGGG - Intergenic
1097937115 12:65265192-65265214 CAACATTTCAAGATGGAGGAAGG + Intergenic
1098641251 12:72840144-72840166 CAGCACATTGAGAGGGAGCATGG + Intergenic
1099702406 12:86103699-86103721 CATCATCTCAAGATGGGGAAGGG + Intronic
1100201454 12:92302819-92302841 CATCATCTCTAGAAGCAGCATGG - Intergenic
1100706705 12:97208346-97208368 AATCATCTCAAGATGGATCAGGG + Intergenic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1108505359 13:51108019-51108041 CAGCACCTTCAGAGGGAGCATGG - Intergenic
1109817327 13:67602306-67602328 CACCATCTTGAGATGGAAAAGGG - Intergenic
1112322420 13:98419781-98419803 AAGCATCTAGAGATAGAGCAGGG + Intronic
1113205231 13:107908897-107908919 CAGCCACTCGAAAGGGAGCAGGG - Intergenic
1113651949 13:112039733-112039755 CAGGCTCTGGAGATGGAGCCGGG - Intergenic
1113758407 13:112830719-112830741 CAGCATCTTGAGACTGAGCTTGG - Intronic
1115230134 14:31151636-31151658 CAGCACTTTGAGATGGAGGAGGG - Intronic
1117993749 14:61459452-61459474 CAGCATATCGAGGTTGAACAGGG + Intronic
1118305919 14:64655322-64655344 CTGCCTCTCCAAATGGAGCAGGG - Intergenic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118621932 14:67621284-67621306 AAGCATCTCAAGATGGAGTTAGG - Intronic
1125427152 15:39560586-39560608 CAGCAACTCCAGATGTGGCACGG - Intergenic
1128657946 15:69476248-69476270 CAGCAACTAGAGAAGGAGCCAGG - Intergenic
1129787615 15:78320063-78320085 CAGCGTTTCGAGATGGGGAAGGG + Intergenic
1133164594 16:3937676-3937698 CAGGCTCTGGAGATGGAGCTGGG + Intergenic
1135102984 16:19623118-19623140 CAGCAGCTAGAAATGGATCATGG + Intronic
1136716449 16:32287068-32287090 CAGCTCCTCAAGGTGGAGCAGGG - Intergenic
1136834835 16:33493346-33493368 CAGCTCCTCAAGGTGGAGCAGGG - Intergenic
1203009968 16_KI270728v1_random:230686-230708 CAGCTCCTCAAGGTGGAGCAGGG + Intergenic
1147677552 17:42218589-42218611 CAGCAACTGGAGATGGAGTTGGG + Intronic
1147688486 17:42300982-42301004 CAGCAACTGGAGATGGAGTTGGG - Intronic
1152458082 17:80427438-80427460 AAGCATCTAGAAATAGAGCAAGG + Intronic
1154140447 18:11818992-11819014 CAGCATGGCGAGTGGGAGCAGGG + Intronic
1155223103 18:23703170-23703192 CAGCATCTCTAGTGGGAGCTAGG - Intronic
1156195249 18:34767616-34767638 CAGAGTCTCAAGATGGTGCAGGG + Intronic
1156613186 18:38751661-38751683 CAGCTTCTCAGGATGAAGCAGGG + Intergenic
1164709204 19:30343447-30343469 CCTCAACTGGAGATGGAGCAGGG - Intronic
1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG + Intergenic
925963219 2:9038487-9038509 CACCATCACGAGCTGAAGCAGGG + Intergenic
927311252 2:21634115-21634137 CAGCATGTCAGGAAGGAGCAAGG + Intergenic
931430516 2:62205561-62205583 CAGGAATCCGAGATGGAGCAGGG + Intronic
931977954 2:67664108-67664130 CAGCAGCTCAAGGAGGAGCAGGG + Intergenic
932016032 2:68027108-68027130 CAGGATCTAGAGATGGGGCAAGG - Intergenic
932776396 2:74530485-74530507 CAGGATCTCGATATAGACCACGG - Exonic
937117833 2:119421441-119421463 CATCATCTTGAGATGGTGCAGGG + Intergenic
937266993 2:120623027-120623049 CAGCACCTGGAGATGGGGCAGGG + Intergenic
937363338 2:121244093-121244115 CAGGAGCTGGAGGTGGAGCAGGG - Intronic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
938569057 2:132545565-132545587 CAGCATCTGGATCTGGAACAGGG - Intronic
939065585 2:137479688-137479710 CAGCATCTAGAAATGGTGCCTGG + Intronic
941344605 2:164352161-164352183 TAGCATCTTCAGAGGGAGCATGG - Intergenic
942610647 2:177738872-177738894 CGGCCTCTAGAGATGGACCAGGG + Intronic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG + Intronic
946336965 2:219044228-219044250 CAGAATCTCAGGATGGAGAAAGG - Intergenic
948404789 2:237709213-237709235 CATCATCTTGAGCTGGAGCTAGG + Intronic
948756095 2:240160503-240160525 CAGGACCACGAGATGGTGCAGGG - Intergenic
1168848625 20:961639-961661 CAGCATCTGGAGATGGGGTGTGG + Intronic
1170220906 20:13940630-13940652 CAGCATCATGAGTGGGAGCAGGG + Intronic
1171208832 20:23301600-23301622 GAACATCTGGAGAGGGAGCAGGG + Intergenic
1171276243 20:23858519-23858541 TAGGACCTGGAGATGGAGCACGG + Intergenic
1172105936 20:32517354-32517376 CAGCAGCTGGAGAGGGAGAAGGG + Intronic
1173795560 20:45857205-45857227 CAGCGGCTCGAGGTTGAGCACGG + Exonic
1174751066 20:53111958-53111980 CAGCATCTCAGGATGGGGCAAGG - Intronic
1176079970 20:63267604-63267626 CAGGACCTCCAGAGGGAGCACGG - Intronic
1178784184 21:35637268-35637290 CAGCATCTAAAGAGGGAGAAAGG + Intronic
1181016487 22:20072217-20072239 AAGCATCTTCAGATGGAGTAGGG + Intergenic
1181579499 22:23819943-23819965 CAGCCTCTCGAGGAGGAGCTGGG + Intronic
1184123889 22:42472973-42472995 CAGCATCTCAGAAAGGAGCAGGG + Intergenic
1184379328 22:44135180-44135202 CAGGAGCTCCAGATGGAGCCTGG - Intronic
950104173 3:10377821-10377843 CAGCAGCTGGAGAGGGTGCAGGG - Intronic
950140161 3:10609748-10609770 CAGCATCTTTAGATGGCTCAGGG + Intronic
952291770 3:32023596-32023618 CAACAAATTGAGATGGAGCAGGG - Intronic
953901046 3:46844601-46844623 CAGCAGCCCCAGAAGGAGCAGGG - Intergenic
959245495 3:103862717-103862739 CAGCCTCTCAAGATGGTGCAGGG - Intergenic
959474428 3:106791380-106791402 CAGCATCTCTAGATCCAGCTGGG + Intergenic
960304024 3:116039525-116039547 CAGCTTTTCAAGATGGTGCATGG - Intronic
962151046 3:132893670-132893692 CTGCATCTTGGGATGGACCATGG - Intergenic
962313438 3:134342215-134342237 TAGCATCTTCAGAGGGAGCATGG + Intergenic
963824179 3:149933156-149933178 CAGCCTCTTAAGATGGTGCAGGG + Intronic
966878165 3:184335377-184335399 CACCTTCTCTAGAGGGAGCAGGG - Intronic
968721165 4:2206240-2206262 CATCAGCTCAAGATGGATCAAGG + Intronic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
980039288 4:127920792-127920814 CAGCATCTGGAAGTGGAGCCCGG - Exonic
984595977 4:181668463-181668485 CAGCACCTTTGGATGGAGCATGG - Intergenic
984706745 4:182852769-182852791 CCCCATCTGGAAATGGAGCAGGG - Intergenic
986649139 5:9946656-9946678 CAGCATCTTGAGATGGGGAGAGG + Intergenic
988606657 5:32684487-32684509 CAGCATCTTGAGGTGGCACAGGG - Intergenic
991763810 5:69952316-69952338 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991783515 5:70165823-70165845 CAGAATTTCAAGATGGAGAAAGG - Intergenic
991843041 5:70827384-70827406 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991875960 5:71166153-71166175 CAGAATTTCAAGATGGAGAAAGG - Intergenic
994922936 5:106074471-106074493 AATCAACTCGAGATGGATCAAGG + Intergenic
999755900 5:154664068-154664090 CAGCCTCTGGAGGTGGTGCAGGG + Intergenic
1000404114 5:160868143-160868165 CAGCTTCTCTAGATGCAGAAAGG - Intergenic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1002570063 5:180135110-180135132 CACAATCTCGAGATGGATTAGGG + Intronic
1004506392 6:16250209-16250231 CACCACCTCCAGATGGAGGAGGG + Intronic
1005530704 6:26702448-26702470 CAGCACCTAGAGATGGATCTGGG + Intergenic
1005531498 6:26711296-26711318 CAGCACCTAGAGATGGATCTGGG + Intergenic
1005539297 6:26790366-26790388 CAGCACCTAGAGATGGATCTGGG - Intergenic
1005540092 6:26799198-26799220 CAGCACCTAGAGATGGATCTGGG - Intergenic
1009010909 6:57841304-57841326 CAGCACCTAGAGATGGATCTGGG - Intergenic
1010562046 6:77362604-77362626 CAGCATCCTGAGGTGGTGCAGGG + Intergenic
1013455629 6:110326876-110326898 CAGCCTCCCGGGGTGGAGCAGGG + Intronic
1013961164 6:115902099-115902121 CAGCAGCTCCAGATGGAAGATGG + Intergenic
1014561973 6:122901675-122901697 CAGCACTAAGAGATGGAGCAAGG - Intergenic
1016108339 6:140189725-140189747 CAGCCTCTCGAGATTGAACCAGG + Intergenic
1017712195 6:157180932-157180954 CAGCATGTGGAGGTGGGGCATGG - Intronic
1017942933 6:159068971-159068993 CAGCATCTCGGGGTGGAGGATGG - Intergenic
1020114148 7:5466345-5466367 CAGCACCTCCAGGAGGAGCACGG - Intronic
1021489061 7:21198563-21198585 CAGCATCTCGGGCTGAATCAGGG - Intergenic
1022470456 7:30678951-30678973 CACCATCTGGAGAGGGAGCCTGG - Intronic
1023212320 7:37819996-37820018 CAGCTTCTCTGGGTGGAGCAGGG + Intronic
1023542660 7:41282943-41282965 GAGCATCTCAAGAGGGAACAGGG + Intergenic
1023542665 7:41282990-41283012 GAGCATCTCAAGAGGGAACAGGG + Intergenic
1024176333 7:46844628-46844650 CAACATCTGCAGAGGGAGCATGG - Intergenic
1029852670 7:103481067-103481089 CAGCATGTTGACAGGGAGCAAGG + Intronic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1031124366 7:117756573-117756595 CATCATCTGGAGAGGGATCATGG + Exonic
1033877590 7:145842049-145842071 CAGCATCCCCAGATGTACCAGGG - Intergenic
1034997609 7:155587930-155587952 CAGCATCTGAATGTGGAGCAGGG + Intergenic
1036212736 8:6855300-6855322 CAGCATTGTGAGATGGAGCATGG - Intergenic
1037313885 8:17582908-17582930 TAGCATCCCGAGGTGGTGCACGG - Intronic
1038478882 8:27887719-27887741 CACAAGCCCGAGATGGAGCAGGG + Intronic
1039095164 8:33876325-33876347 AAGCAACTCAAGATGGATCAAGG - Intergenic
1040105477 8:43539145-43539167 CACCTTCTCGACATGCAGCAGGG - Intergenic
1040436632 8:47397825-47397847 CAGCCTCTAGAGAGGGTGCAGGG + Intronic
1041318453 8:56588893-56588915 TAGGATCACGAGATAGAGCAAGG - Intergenic
1041742287 8:61168836-61168858 AAGCATCTTTAGTTGGAGCAGGG - Intronic
1043448264 8:80340474-80340496 CAGCTTCCCCAGATGGGGCAAGG + Intergenic
1046407424 8:113791531-113791553 CAGCAGCTCCAGATGGGCCACGG + Intergenic
1049511851 8:143031408-143031430 CAACATAGTGAGATGGAGCAGGG + Intergenic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1052619251 9:30884014-30884036 CAGTGTCTGGTGATGGAGCATGG - Intergenic
1053461908 9:38277946-38277968 CAGCAAGTTGAGATGGAGCCCGG - Intergenic
1056052263 9:82781449-82781471 CAGAAACTCGGGGTGGAGCAAGG + Intergenic
1057093060 9:92277562-92277584 CAGCTACTCGGGATGGGGCAGGG + Intronic
1057313841 9:93956920-93956942 CAGCAGCTGGAGCTGGAGAAAGG - Intergenic
1057480267 9:95439830-95439852 CACCACCTCGAGATGCAGAAAGG - Intergenic
1057865072 9:98674088-98674110 CATCATCTAGAGAGGGAACAGGG + Intronic
1061825742 9:133257184-133257206 CAGCCTCTGGAGAAGGAGCTGGG + Intronic
1203785401 EBV:124756-124778 CAGGATCTCCAGATCCAGCATGG + Intergenic
1185508411 X:645090-645112 CAGCCTCTCGGGATGAAGGAAGG - Exonic
1185827253 X:3263983-3264005 CAGCATATAGAGATGGGGCCAGG - Intergenic
1186522141 X:10215062-10215084 CAGCATCTCATGATAGACCAGGG + Intronic
1191140425 X:57110674-57110696 AATCATCTCAAGATGGATCAAGG + Intergenic
1192154721 X:68735904-68735926 AATCAACTCGAGATGGATCAAGG + Intergenic
1192287772 X:69756402-69756424 CAGCATCTGTAGTTGGATCAGGG + Intronic
1192565373 X:72158923-72158945 CAGCGTCCTGAGGTGGAGCAGGG + Intergenic
1197681188 X:129387011-129387033 TAGCATCTTTAGAGGGAGCATGG + Intergenic
1197831712 X:130649943-130649965 CAGCATCTTGAGCTGGAGTTTGG + Intronic
1199207928 X:145170966-145170988 CAGCTTATAGAGAGGGAGCAAGG + Intergenic
1199235527 X:145488048-145488070 CAGCATCTTCAGGTGGTGCAGGG + Intergenic
1199439769 X:147854911-147854933 GAGCATCTCCAGATGCTGCAGGG - Intergenic
1199941554 X:152632699-152632721 CAGCCTTTCCAGATGGAGAAAGG + Intergenic
1201675950 Y:16584276-16584298 CAGCCTTTGGAAATGGAGCAGGG - Intergenic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic