ID: 1166237540

View in Genome Browser
Species Human (GRCh38)
Location 19:41467399-41467421
Sequence CTGCTAGTATCCAGGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166237540_1166237544 -9 Left 1166237540 19:41467399-41467421 CCTTTCTTCCTGGATACTAGCAG No data
Right 1166237544 19:41467413-41467435 TACTAGCAGCAATATCACAGGGG No data
1166237540_1166237543 -10 Left 1166237540 19:41467399-41467421 CCTTTCTTCCTGGATACTAGCAG No data
Right 1166237543 19:41467412-41467434 ATACTAGCAGCAATATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166237540 Original CRISPR CTGCTAGTATCCAGGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr