ID: 1166237560

View in Genome Browser
Species Human (GRCh38)
Location 19:41467554-41467576
Sequence TTGTTTCTAATATCCAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166237560_1166237564 -9 Left 1166237560 19:41467554-41467576 CCTAGCTTGGATATTAGAAACAA No data
Right 1166237564 19:41467568-41467590 TAGAAACAATATCACAGGAGGGG No data
1166237560_1166237566 14 Left 1166237560 19:41467554-41467576 CCTAGCTTGGATATTAGAAACAA No data
Right 1166237566 19:41467591-41467613 TGTACACCCACTGCGATATCGGG No data
1166237560_1166237565 13 Left 1166237560 19:41467554-41467576 CCTAGCTTGGATATTAGAAACAA No data
Right 1166237565 19:41467590-41467612 GTGTACACCCACTGCGATATCGG No data
1166237560_1166237563 -10 Left 1166237560 19:41467554-41467576 CCTAGCTTGGATATTAGAAACAA No data
Right 1166237563 19:41467567-41467589 TTAGAAACAATATCACAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166237560 Original CRISPR TTGTTTCTAATATCCAAGCT AGG (reversed) Intergenic
No off target data available for this crispr