ID: 1166237565

View in Genome Browser
Species Human (GRCh38)
Location 19:41467590-41467612
Sequence GTGTACACCCACTGCGATAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166237560_1166237565 13 Left 1166237560 19:41467554-41467576 CCTAGCTTGGATATTAGAAACAA No data
Right 1166237565 19:41467590-41467612 GTGTACACCCACTGCGATATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166237565 Original CRISPR GTGTACACCCACTGCGATAT CGG Intergenic
No off target data available for this crispr