ID: 1166239555

View in Genome Browser
Species Human (GRCh38)
Location 19:41480631-41480653
Sequence AGTTATATGAAGAAACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166239555_1166239560 1 Left 1166239555 19:41480631-41480653 CCCTCCAGTTTCTTCATATAACT No data
Right 1166239560 19:41480655-41480677 ATTGGTATCCACAGCACTCCGGG No data
1166239555_1166239562 14 Left 1166239555 19:41480631-41480653 CCCTCCAGTTTCTTCATATAACT No data
Right 1166239562 19:41480668-41480690 GCACTCCGGGTTTCCTCTTTTGG No data
1166239555_1166239559 0 Left 1166239555 19:41480631-41480653 CCCTCCAGTTTCTTCATATAACT No data
Right 1166239559 19:41480654-41480676 CATTGGTATCCACAGCACTCCGG No data
1166239555_1166239564 20 Left 1166239555 19:41480631-41480653 CCCTCCAGTTTCTTCATATAACT No data
Right 1166239564 19:41480674-41480696 CGGGTTTCCTCTTTTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166239555 Original CRISPR AGTTATATGAAGAAACTGGA GGG (reversed) Intergenic
No off target data available for this crispr