ID: 1166242708

View in Genome Browser
Species Human (GRCh38)
Location 19:41505076-41505098
Sequence GCATATACACCCCTGTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166242708_1166242709 -9 Left 1166242708 19:41505076-41505098 CCATATCACAGGGGTGTATATGC No data
Right 1166242709 19:41505090-41505112 TGTATATGCCCCCCGCGACATGG No data
1166242708_1166242715 18 Left 1166242708 19:41505076-41505098 CCATATCACAGGGGTGTATATGC No data
Right 1166242715 19:41505117-41505139 TAATATCTCCCTCTCCCCTCCGG No data
1166242708_1166242716 19 Left 1166242708 19:41505076-41505098 CCATATCACAGGGGTGTATATGC No data
Right 1166242716 19:41505118-41505140 AATATCTCCCTCTCCCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166242708 Original CRISPR GCATATACACCCCTGTGATA TGG (reversed) Intergenic
No off target data available for this crispr