ID: 1166242709

View in Genome Browser
Species Human (GRCh38)
Location 19:41505090-41505112
Sequence TGTATATGCCCCCCGCGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166242699_1166242709 17 Left 1166242699 19:41505050-41505072 CCTCTCCGCCCCCGGGATATCAC No data
Right 1166242709 19:41505090-41505112 TGTATATGCCCCCCGCGACATGG No data
1166242700_1166242709 12 Left 1166242700 19:41505055-41505077 CCGCCCCCGGGATATCACAAACC No data
Right 1166242709 19:41505090-41505112 TGTATATGCCCCCCGCGACATGG No data
1166242708_1166242709 -9 Left 1166242708 19:41505076-41505098 CCATATCACAGGGGTGTATATGC No data
Right 1166242709 19:41505090-41505112 TGTATATGCCCCCCGCGACATGG No data
1166242702_1166242709 8 Left 1166242702 19:41505059-41505081 CCCCGGGATATCACAAACCATAT No data
Right 1166242709 19:41505090-41505112 TGTATATGCCCCCCGCGACATGG No data
1166242701_1166242709 9 Left 1166242701 19:41505058-41505080 CCCCCGGGATATCACAAACCATA No data
Right 1166242709 19:41505090-41505112 TGTATATGCCCCCCGCGACATGG No data
1166242698_1166242709 18 Left 1166242698 19:41505049-41505071 CCCTCTCCGCCCCCGGGATATCA No data
Right 1166242709 19:41505090-41505112 TGTATATGCCCCCCGCGACATGG No data
1166242704_1166242709 6 Left 1166242704 19:41505061-41505083 CCGGGATATCACAAACCATATCA No data
Right 1166242709 19:41505090-41505112 TGTATATGCCCCCCGCGACATGG No data
1166242703_1166242709 7 Left 1166242703 19:41505060-41505082 CCCGGGATATCACAAACCATATC No data
Right 1166242709 19:41505090-41505112 TGTATATGCCCCCCGCGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166242709 Original CRISPR TGTATATGCCCCCCGCGACA TGG Intergenic