ID: 1166242715

View in Genome Browser
Species Human (GRCh38)
Location 19:41505117-41505139
Sequence TAATATCTCCCTCTCCCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166242713_1166242715 -7 Left 1166242713 19:41505101-41505123 CCCGCGACATGGAGAGTAATATC No data
Right 1166242715 19:41505117-41505139 TAATATCTCCCTCTCCCCTCCGG No data
1166242710_1166242715 -4 Left 1166242710 19:41505098-41505120 CCCCCCGCGACATGGAGAGTAAT No data
Right 1166242715 19:41505117-41505139 TAATATCTCCCTCTCCCCTCCGG No data
1166242712_1166242715 -6 Left 1166242712 19:41505100-41505122 CCCCGCGACATGGAGAGTAATAT No data
Right 1166242715 19:41505117-41505139 TAATATCTCCCTCTCCCCTCCGG No data
1166242708_1166242715 18 Left 1166242708 19:41505076-41505098 CCATATCACAGGGGTGTATATGC No data
Right 1166242715 19:41505117-41505139 TAATATCTCCCTCTCCCCTCCGG No data
1166242714_1166242715 -8 Left 1166242714 19:41505102-41505124 CCGCGACATGGAGAGTAATATCT No data
Right 1166242715 19:41505117-41505139 TAATATCTCCCTCTCCCCTCCGG No data
1166242711_1166242715 -5 Left 1166242711 19:41505099-41505121 CCCCCGCGACATGGAGAGTAATA No data
Right 1166242715 19:41505117-41505139 TAATATCTCCCTCTCCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166242715 Original CRISPR TAATATCTCCCTCTCCCCTC CGG Intergenic