ID: 1166244594

View in Genome Browser
Species Human (GRCh38)
Location 19:41516605-41516627
Sequence CCAGACCCGAAACCAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 31, 1: 84, 2: 94, 3: 57, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166244594_1166244601 2 Left 1166244594 19:41516605-41516627 CCCAGGCCTGGTTTCGGGTCTGG 0: 31
1: 84
2: 94
3: 57
4: 224
Right 1166244601 19:41516630-41516652 TTGGATCTGGTGCCTGGCGCCGG No data
1166244594_1166244602 3 Left 1166244594 19:41516605-41516627 CCCAGGCCTGGTTTCGGGTCTGG 0: 31
1: 84
2: 94
3: 57
4: 224
Right 1166244602 19:41516631-41516653 TGGATCTGGTGCCTGGCGCCGGG No data
1166244594_1166244604 17 Left 1166244594 19:41516605-41516627 CCCAGGCCTGGTTTCGGGTCTGG 0: 31
1: 84
2: 94
3: 57
4: 224
Right 1166244604 19:41516645-41516667 GGCGCCGGGCTGCCTGCCTTTGG 0: 5
1: 45
2: 103
3: 200
4: 350
1166244594_1166244600 -4 Left 1166244594 19:41516605-41516627 CCCAGGCCTGGTTTCGGGTCTGG 0: 31
1: 84
2: 94
3: 57
4: 224
Right 1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166244594 Original CRISPR CCAGACCCGAAACCAGGCCT GGG (reversed) Intergenic
900406393 1:2494962-2494984 CCAGACCGGGACCCTGGCCTGGG - Intronic
900955816 1:5885670-5885692 CCAGAGCAGAATCCAGGCCGAGG + Intronic
902564494 1:17302048-17302070 TCAGACCCAAAACCAGGTCGTGG - Intergenic
902731728 1:18374168-18374190 GCAGATGGGAAACCAGGCCTAGG - Intronic
904029166 1:27523300-27523322 CCAGACTGGAGCCCAGGCCTAGG + Intergenic
904170308 1:28587259-28587281 CCAGGCCCAAAACCGGACCTGGG - Intergenic
904260236 1:29283789-29283811 CCCCACCCGAAGGCAGGCCTGGG - Intronic
904433939 1:30482120-30482142 TCAGACCCAACACCAGGCCGGGG - Intergenic
904573162 1:31483223-31483245 CCAGGCCAAAAACCAGGCCTGGG - Intergenic
904617459 1:31757689-31757711 GCAGGCCCTGAACCAGGCCTTGG - Intronic
905775951 1:40667282-40667304 CCAGGCCCTAGTCCAGGCCTAGG - Intergenic
905861872 1:41357529-41357551 ACAGACCACAGACCAGGCCTGGG - Intergenic
906497534 1:46315907-46315929 CCAGATCCTAAACCAGTGCTTGG - Intronic
906498925 1:46325901-46325923 CCAGGCCCGAAACCAAGCCTGGG - Intergenic
906499673 1:46332422-46332444 CCAGGCCCGAAACCAGGCCCTGG - Intergenic
908401618 1:63776634-63776656 CCAGACCCGAAACCAGGCCTGGG - Intronic
908729849 1:67214850-67214872 CCAGGCCCGAAACCAGGACTGGG + Intronic
909530018 1:76671605-76671627 CCAGACTCAAAACCTGGCCTTGG - Intergenic
910614554 1:89182800-89182822 CCAGGCCCAAAACCAGGCCTGGG - Exonic
911909633 1:103616542-103616564 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
911911903 1:103648037-103648059 CCAGGCCCAAAAACAGACCTGGG - Intergenic
911916551 1:103703911-103703933 CCAGGCCCAAAAACAGACCTGGG + Intronic
911919318 1:103742175-103742197 CCAGGCCCAAAAACAGACCTGGG - Intronic
911987370 1:104645001-104645023 TCAGAGATGAAACCAGGCCTGGG + Intergenic
912359743 1:109085372-109085394 CCACACCTGAAACCAGGCCTAGG - Intergenic
915175351 1:154010095-154010117 CTGTACCCCAAACCAGGCCTTGG - Exonic
916512440 1:165484164-165484186 ACAGACCTGGAACCAGACCTAGG - Intergenic
916750622 1:167720286-167720308 CCAGACCCGAAACCAGGCCTGGG - Intergenic
916766201 1:167863181-167863203 CCAGACCCGAAACCAGGCCTGGG + Intronic
916766874 1:167869527-167869549 CCAGACCCGAAACCAGGCCTGGG + Intronic
917115625 1:171600550-171600572 CCAGGCCTGAAACCAGGCCTGGG + Intergenic
917117299 1:171615529-171615551 CCAGGCCTGAAACCAGGCCTGGG + Intergenic
918242414 1:182632469-182632491 CCAGACCCGAAACCAGGCCTGGG + Intergenic
919334704 1:196217362-196217384 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
920449949 1:206052626-206052648 CCAGGCCCGAAACCAGGCCTGGG + Intronic
920450595 1:206058538-206058560 CCAGGCCCAAAACCAGGCCTGGG + Intronic
920792693 1:209107763-209107785 CCAGACCTGAAACCAGGCCTGGG - Intergenic
921926878 1:220718128-220718150 CCAGATCTGAAACCAGGCCTGGG + Intergenic
922694117 1:227719298-227719320 CCAGACCTGAAATGAGGCCTGGG + Intergenic
922914458 1:229244739-229244761 CCAGTCCCAAAACCAGGCCTGGG - Intergenic
924819646 1:247476509-247476531 TCAGACCCGAAACCAGGCCTGGG - Intergenic
1062979271 10:1708335-1708357 GCAGACCCCACACCAAGCCTTGG + Intronic
1063142147 10:3264798-3264820 CCAGCCCTGAAACCAGCCCAAGG - Intergenic
1064396001 10:14982461-14982483 CCAGACCCACAACCACACCTGGG - Intronic
1064397702 10:14994647-14994669 CCAGACCCAAAACCACACCTGGG - Intergenic
1064787586 10:18915996-18916018 CATGACCCCAAACCAGGCCCTGG - Intergenic
1065564843 10:26997984-26998006 TCAGACCCAACACCAGGCCGTGG - Intronic
1065802008 10:29360787-29360809 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1066673736 10:37866084-37866106 CCAGACCTGAAACCAGGCCTGGG + Intergenic
1066704165 10:38159658-38159680 TCAGACCCAACACCAGGCCATGG + Intergenic
1066792662 10:39083088-39083110 TCAGACCCAAAACCAGGCCATGG + Intergenic
1066976932 10:42377730-42377752 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1066986448 10:42472221-42472243 TCAGACCCAACACCAGGCCATGG - Intergenic
1067541386 10:47157098-47157120 ACAGACACGAAATCAAGCCTGGG - Intergenic
1068174414 10:53439319-53439341 CCAGACCCAAAACCAGGCTTGGG - Intergenic
1069320090 10:67159019-67159041 CCACGCCTGAAACCAGGCCTGGG + Intronic
1069487530 10:68833710-68833732 TCAGACCCGAAACCAGTCCTGGG - Intronic
1070444179 10:76478884-76478906 CCACACCCCACAACAGGCCTTGG - Intronic
1070576532 10:77683114-77683136 CCAGGCCCGAAACCTGGCTTGGG + Intergenic
1071288132 10:84167538-84167560 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
1071288637 10:84172339-84172361 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
1072689382 10:97561678-97561700 CCAGGCCCAAAACCAGACCTGGG - Intronic
1072770420 10:98133193-98133215 CCAGACCTGAAACCAGGCCTGGG + Intergenic
1072832199 10:98670624-98670646 CCAGGCCCAAAACCAGGCCTGGG + Intronic
1074300202 10:112226499-112226521 TCAGACCCAACACCAGGCCATGG + Intergenic
1074302059 10:112241913-112241935 CCAGACCCAAAGCCAAGCCAAGG + Intergenic
1075199273 10:120388461-120388483 GCAGCCCCTAAACCAGGCTTGGG - Intergenic
1075478994 10:122763342-122763364 TCAGACCTGACACCAGGCCGTGG + Intergenic
1075713823 10:124544555-124544577 CCAGACCCGAATCCACCTCTGGG + Intronic
1076408360 10:130229033-130229055 CCAGACAGGAAAGCAGCCCTGGG + Intergenic
1076941160 10:133609936-133609958 TCAGACCCAACACCAGGCCATGG - Intergenic
1079076081 11:17386334-17386356 CCAGACCTGAAACTGGCCCTCGG + Exonic
1081305791 11:41510388-41510410 CCACACCCCACACCAGGGCTTGG + Intergenic
1081442084 11:43091723-43091745 CCAGCACTGGAACCAGGCCTAGG + Intergenic
1082179582 11:49101961-49101983 CCATACCCAAACCCAGGCCTTGG + Intergenic
1083136665 11:60684629-60684651 CCAGACCCAAAACCAGGCCTGGG - Intergenic
1083383321 11:62286827-62286849 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
1083387934 11:62325894-62325916 CCAGGCCCAAAACCAGTCCTGGG + Intergenic
1085031156 11:73271656-73271678 CCAGACCCGAAACCAGGCCTGGG - Intronic
1085050599 11:73378098-73378120 CCAGACCAGAGACCACTCCTGGG - Intronic
1085118817 11:73953677-73953699 CCAGGCCTGAAACCAGGCCTGGG - Intronic
1085180888 11:74535131-74535153 CCAGACCCGAAACCAGGCCTGGG - Intronic
1085240454 11:75049743-75049765 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1085998476 11:81951314-81951336 CCAGACCCGAAATCAGGCCTGGG + Intergenic
1086423039 11:86656585-86656607 CCCCACCCCAAAACAGGCCTTGG - Intronic
1086685705 11:89730957-89730979 CCATATCCAAACCCAGGCCTTGG - Intergenic
1086700495 11:89896241-89896263 CCAGAGCAAAACCCAGGCCTTGG + Intergenic
1086705674 11:89948285-89948307 CCAGAGCAAAACCCAGGCCTTGG - Intergenic
1086745611 11:90423062-90423084 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1086759773 11:90613256-90613278 CCAGACCCGAAACCAGGCCTGGG - Intergenic
1086824694 11:91482048-91482070 CCAGGCCTGAATCCAGGCCTGGG - Intergenic
1089376199 11:117996441-117996463 CCAGGCCAGAGACCAGGCCGAGG - Intronic
1089826347 11:121281559-121281581 CCAGACCCAACACCAGGCCGTGG - Intergenic
1091584971 12:1810967-1810989 CCACACCAGCAACGAGGCCTGGG - Intronic
1091700227 12:2654145-2654167 CAAGAGCAGAACCCAGGCCTCGG - Intronic
1092326894 12:7542221-7542243 CCAGACCTGAAATCAGGCCAGGG + Intergenic
1092435463 12:8443503-8443525 CCAGACCCACAACCACACCTGGG - Intergenic
1092436396 12:8449869-8449891 CCAGGCTCAAAACGAGGCCTGGG - Intergenic
1092570232 12:9713468-9713490 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1093421790 12:18982414-18982436 CCAGACCCGAAACCAGGCCTGGG + Intergenic
1094802092 12:34048628-34048650 TCAGACCCAACACCAGGCCATGG - Intergenic
1095727154 12:45466423-45466445 CCAGACACAAAGCCAGGACTGGG + Intergenic
1096040060 12:48507388-48507410 TCAGACCCAACACCAGGCCATGG - Intronic
1096905315 12:54930305-54930327 CCAGACCCAAAACCAGGCCTGGG + Intergenic
1096996613 12:55842242-55842264 CCTGACCCTAAACCATGCCAGGG - Intronic
1097281196 12:57846292-57846314 ACAGCCCCGAACCCAGGTCTCGG - Intronic
1097754990 12:63399098-63399120 TCAGACCCAACACTAGGCCTTGG + Intergenic
1098639753 12:72824671-72824693 CCAGGCCCAAAACCAGGCCTGGG - Intergenic
1098719456 12:73877642-73877664 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
1098914277 12:76240895-76240917 TCAGACCCAACACCAGGCCATGG - Intergenic
1099488278 12:83254860-83254882 CCTGACCCAGAGCCAGGCCTAGG + Intergenic
1100658851 12:96675925-96675947 CCCCACCCCAAAACAGGCCTCGG - Intronic
1100855695 12:98755449-98755471 CCAGACCCAGTACCAGGCGTTGG - Intronic
1100959398 12:99945786-99945808 CCAGAGAAGAAAACAGGCCTGGG + Intronic
1101908138 12:108843119-108843141 CCAGCCCCTAAAACAGGGCTTGG + Intronic
1102074537 12:110049256-110049278 CCAGGCCCGAAACCAGGCCTGGG + Intronic
1103954410 12:124568143-124568165 CCAGACCCGAGACCCAGCCCGGG + Intergenic
1104013435 12:124947759-124947781 CCAGTCCCCAAACCAGTCCTCGG + Exonic
1104013715 12:124949164-124949186 CCAGCCCCGAGAACATGCCTGGG + Intronic
1104687786 12:130800026-130800048 ACAGATCCGAAACCAGGCTCAGG + Intronic
1104706575 12:130951876-130951898 CCAGCCCCGAGAACAGGGCTTGG - Intergenic
1105695065 13:22880387-22880409 CCAGGCCCGAAACCAGGCCTGGG + Intergenic
1105695399 13:22883655-22883677 CCAGGTCTGAAACCAGGCCTGGG + Intergenic
1105696006 13:22889475-22889497 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
1106549350 13:30758055-30758077 CCAGAGACCAAACCTGGCCTCGG + Intronic
1106643660 13:31610487-31610509 CCAGGCTCGAAACCAGGCCTGGG - Intergenic
1106684649 13:32045335-32045357 GCAGACCTGGAACCAGGCCTTGG - Intronic
1107017324 13:35718050-35718072 CCAGACACGAACCCAAGCCATGG - Intergenic
1107544634 13:41424402-41424424 CCAGACCCACAACCACACCTGGG - Intergenic
1107997069 13:45871477-45871499 CCAGGCCCAAAACCAGGCCTGGG - Intergenic
1108098695 13:46932430-46932452 CCAGACCCAACACCAGGTCATGG + Intergenic
1108253810 13:48591790-48591812 CCAGGCCCGAAACCAGGCCTAGG - Intergenic
1108935292 13:55874577-55874599 TCAGACCCAACACCAGGCCATGG - Intergenic
1109403271 13:61862993-61863015 TCAGACCCAACACCAGGCCATGG + Intergenic
1111974580 13:94952109-94952131 ACAGACTCTAAACCAGGCCCTGG - Intergenic
1112678930 13:101739847-101739869 CCAGGCCTGAAACCAGGCCTGGG + Intronic
1114378495 14:22175137-22175159 CCAGGCCCGAAACCAGGTCTGGG + Intergenic
1116047554 14:39763275-39763297 CCAGACCTGAAACCAGGCCTGGG - Intergenic
1116057065 14:39876815-39876837 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1118409051 14:65457819-65457841 CCAGGCCCAAAACCAGGCCTGGG - Intronic
1118457375 14:65957230-65957252 CCAGGCTCAAAACCAGGCCTGGG - Intergenic
1120020964 14:79529388-79529410 CCAGGCCCGAAACCAGGCCTGGG - Intronic
1121349924 14:93165219-93165241 CCAGGCCCAAAACCAGGCCATGG + Intergenic
1121707872 14:96012977-96012999 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
1122143971 14:99677877-99677899 TCAGGCCCCAAACCAGGCCTGGG + Exonic
1122482509 14:102056111-102056133 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
1124392412 15:29271485-29271507 CCAGGCCCAAAACCAGGCCTGGG + Intronic
1124530557 15:30501881-30501903 CCAGGCCCAAAACCAGGCCTGGG - Intergenic
1124768102 15:32505817-32505839 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
1124931257 15:34121818-34121840 CCAGACCCGAAACCAGGCCTAGG + Intergenic
1125005574 15:34812975-34812997 CCAGACCCGAAACCAGGCCTGGG + Intergenic
1126690137 15:51282655-51282677 TCAGATCCAACACCAGGCCTTGG - Intronic
1126690541 15:51285891-51285913 TCAGATCCAACACCAGGCCTTGG - Intronic
1127776685 15:62269589-62269611 TCAGACCCAACACCAGGCCATGG + Intergenic
1128147850 15:65342556-65342578 CCAGACCCGAAGCAAGGTCGTGG + Intronic
1128202982 15:65825761-65825783 CCAGACCCGAAACCAGGCCTGGG + Intronic
1129167267 15:73785814-73785836 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1129374181 15:75117224-75117246 TCAGACCCAACACCAGGCCGTGG + Intronic
1129390727 15:75219567-75219589 CCAGGCCCAAAGCCAGGCCTGGG - Intergenic
1129530856 15:76263291-76263313 TCAGACCCAACACCAGGCCATGG - Intronic
1129531575 15:76269647-76269669 TCAGACCCAACACCAGGCCATGG - Intronic
1130955234 15:88622742-88622764 CCAGACCCAAAACCAGGCCTGGG - Intronic
1131017116 15:89067074-89067096 TCAGACCCAACACCAGGCCATGG + Intergenic
1132461076 16:55111-55133 TCAGTCCCGAAGCCTGGCCTGGG + Intronic
1132855389 16:2042576-2042598 CCAGTCCAGAAACCAGGGCTTGG - Intronic
1133366458 16:5214216-5214238 CCAGGCCTGAAACCAGGCCTGGG + Intergenic
1133900964 16:9974275-9974297 CCAGACCCGAAATCAGGCCTGGG + Intronic
1134155071 16:11836298-11836320 CCAGACCCAACACCAGGTCGTGG - Exonic
1134381285 16:13729056-13729078 CCCCACCCCAAACCAGCCCTTGG + Intergenic
1135231975 16:20716841-20716863 TCAGACCCAATACCAGGCCGTGG - Intronic
1136348103 16:29689641-29689663 CCAGACCCGAAATCAGGCCTGGG + Intronic
1136350984 16:29707594-29707616 CCAGGCCCGAAACCAGGCCTGGG + Intergenic
1138124798 16:54429854-54429876 TCATACCCAAAACCAAGCCTGGG - Intergenic
1138431878 16:56974060-56974082 CCAGACCCGAAACCAGGCCTGGG - Intronic
1138516428 16:57537652-57537674 CCAGACCCGAAAAAAGGCACTGG - Intergenic
1139949833 16:70663444-70663466 ACAGACCCCGAACCAGGCCCAGG + Exonic
1140415807 16:74773490-74773512 CCAGTCCCAGAGCCAGGCCTGGG + Intronic
1141091700 16:81134775-81134797 CCAGACCTGAAACCAGGCCTGGG + Intergenic
1142435868 16:90056866-90056888 CCAGACCCGAAACCAGGCCTGGG - Intronic
1143755688 17:9065639-9065661 CCAGCCTCCAGACCAGGCCTGGG + Intronic
1145227484 17:21142375-21142397 CCAGACCGGAAACCAGGCCTGGG - Intronic
1145875946 17:28318455-28318477 CCAGACCCGCAACCCCGGCTGGG + Intergenic
1145962244 17:28893690-28893712 CCAGGCCCGAAACCAGGCCTGGG + Intronic
1146915192 17:36673872-36673894 ACAGGCCTGAAACCAGTCCTAGG + Intergenic
1148848092 17:50540875-50540897 CCTGTCCCGAAGCCAGCCCTGGG + Exonic
1149667760 17:58377745-58377767 ACAGACCTTCAACCAGGCCTTGG + Intronic
1155252403 18:23964978-23965000 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
1157519313 18:48334463-48334485 CCAGACCCGAAAACACCCCCAGG + Intronic
1157671436 18:49531992-49532014 CCAGACCCGAAACCAAGCCTGGG - Intergenic
1159689825 18:71472607-71472629 CCAGGCCCGAAACTAGGCCTGGG - Intergenic
1160126468 18:76177170-76177192 CCAGACCAGCAACCAGGACAAGG - Intergenic
1160600299 18:80007540-80007562 CCAGGCCCAAAACCAGGCCTGGG - Intronic
1160864066 19:1249511-1249533 CCAGACCCGTCTCCAGACCTGGG + Intronic
1161004844 19:1930018-1930040 CCACGCCCGGACCCAGGCCTGGG + Intergenic
1162281546 19:9702192-9702214 CCAGATCTGAAACCAGGCCTGGG + Intergenic
1162301896 19:9849210-9849232 CCTGCCCCGAGGCCAGGCCTGGG - Exonic
1162693286 19:12451154-12451176 TCAGACCCAACACCAGGCCGTGG - Intronic
1162936184 19:13982881-13982903 CCTGACTCTAAACCTGGCCTTGG + Intronic
1163067821 19:14812340-14812362 CCAGGCCCAAAACCAGGCCTGGG + Intronic
1163433050 19:17279709-17279731 CCAGACCCCAATCCAGGTCAAGG + Intronic
1163907708 19:20161536-20161558 CCAGGCCTGAAACCAGGCCTGGG + Intergenic
1163934721 19:20432473-20432495 CCAGGCCCAAAACCAGCCCTGGG - Intergenic
1164669310 19:30063700-30063722 ACAGACCCTGACCCAGGCCTGGG + Intergenic
1166075412 19:40411244-40411266 CCAGGCCCGGCACCTGGCCTGGG - Intronic
1166230942 19:41425618-41425640 CCAGAGCCGAATGCTGGCCTGGG + Exonic
1166236948 19:41463785-41463807 CCAGACCCGAAACCAGGCCTGGG - Intergenic
1166244594 19:41516605-41516627 CCAGACCCGAAACCAGGCCTGGG - Intergenic
1167245899 19:48373138-48373160 CCAGCCCTGAAGCCTGGCCTTGG - Intronic
1167291211 19:48626093-48626115 CCAAACCTGAAGCCAGGCCCCGG + Exonic
1167581615 19:50347329-50347351 CCAGACCCAAAACCAGGCCTGGG - Intronic
1167890501 19:52535973-52535995 CCAGGACTGAAGCCAGGCCTGGG - Intronic
1167910049 19:52694435-52694457 CCAGACCTGAAACCAGGCCTCGG + Intergenic
1167926043 19:52821650-52821672 GCAGGACAGAAACCAGGCCTGGG + Intronic
1167930227 19:52857636-52857658 GCAGGACAGAAACCAGGCCTGGG + Intronic
1167935074 19:52898877-52898899 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1167935651 19:52904725-52904747 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
1167938117 19:52923731-52923753 CCACGCCCAAAACCAGGCCTGGG + Intergenic
1167999281 19:53431945-53431967 GCAGAGCAGAAGCCAGGCCTGGG - Intergenic
1168005144 19:53480836-53480858 CCAGACCCAACACCAGGCCATGG + Intronic
1168220813 19:54959052-54959074 CCAGACCCGAAACCAGGCCTGGG - Intronic
1168425199 19:56234545-56234567 CCAGGCCCGAAACCAGGCCTGGG + Intronic
1168607075 19:57768759-57768781 CCAGGCCCGAAACCAGGCCTAGG - Intergenic
925288574 2:2731345-2731367 GCACACCTGAGACCAGGCCTTGG + Intergenic
928228553 2:29476299-29476321 CCAGGCCAGAAACTAGGCCTTGG - Intronic
928318673 2:30266267-30266289 CCAGAGCCTAATCCTGGCCTTGG - Intronic
928768542 2:34677288-34677310 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
929218032 2:39436831-39436853 CCCGACCCGCAGCCAAGCCTGGG - Intronic
929246150 2:39705879-39705901 CCAGACCTGTTACCTGGCCTTGG + Intronic
929937079 2:46300745-46300767 CCAGTCCCAAAGCCAGACCTAGG + Intronic
930698887 2:54439579-54439601 CCAGACCCTAACTCAGGCCCTGG - Intergenic
931779351 2:65566021-65566043 CCAGATCTGAGAGCAGGCCTTGG - Intergenic
931883199 2:66588394-66588416 CCAAACCAGAAACCATGCCATGG - Intergenic
932349453 2:71020618-71020640 CCAGACCCACAACCACACCTGGG + Intergenic
932463362 2:71897499-71897521 ACAGCCCTAAAACCAGGCCTGGG + Intergenic
933529981 2:83496493-83496515 CCACACCCTAAAACAGGCCCTGG + Intergenic
935330681 2:101975157-101975179 CCAGACCCGAGAGCACACCTGGG + Intergenic
935345946 2:102108500-102108522 TCAGACCCCAAAGCAGGCCCTGG - Intronic
935722304 2:105990222-105990244 CTGGACCCAAAACCAGGCCATGG - Intergenic
935722831 2:105994777-105994799 CCAGACCCAACACCAGGCCATGG - Intergenic
936427655 2:112434481-112434503 GCAGACCTAGAACCAGGCCTAGG - Intronic
936973655 2:118198307-118198329 TCTGACCAGAAACCAGGTCTTGG + Intergenic
937999019 2:127717220-127717242 CCACCCCTGATACCAGGCCTAGG - Exonic
938911306 2:135888113-135888135 TCAGACCCAACACCAGGCCATGG + Intergenic
940871733 2:158866402-158866424 CCAGACCCACAACCACACCTGGG + Intergenic
941854216 2:170213528-170213550 CCAGACCCGAAACCAGGCCTGGG - Intronic
942325491 2:174772870-174772892 CACGAACCGAAGCCAGGCCTTGG + Intergenic
943621885 2:190157947-190157969 CCAGGCCCAAAATCAGACCTGGG + Intronic
945242027 2:207685105-207685127 CCAGTGCCGAAACCAGGGCCTGG - Intergenic
945741012 2:213661040-213661062 CCAGACCCAACACCAGGCAGTGG - Intronic
947219919 2:227782113-227782135 CCAGAACTGAGACCTGGCCTTGG - Intergenic
947445656 2:230160804-230160826 ACAGAGCCAGAACCAGGCCTAGG + Intergenic
948413957 2:237787210-237787232 CCAGACCCAACACCAGGCTGTGG - Intronic
1170009655 20:11708231-11708253 CCAGGCCCAAAACCAGACCTGGG + Intergenic
1170400731 20:15980221-15980243 CCAGGCCCGAAACCAGGCCTGGG - Intronic
1170401296 20:15986119-15986141 CCAGCCCCGAAACCAGGCCTGGG - Intronic
1170508797 20:17055829-17055851 CCAGACACGAATCCTGGCCTTGG - Intergenic
1170775476 20:19371458-19371480 CAAGACCCCAAGCCTGGCCTTGG + Intronic
1171903831 20:30883028-30883050 CCACACCCCACAACAGGCCTTGG + Intergenic
1173247158 20:41344773-41344795 TCAGACCCACAATCAGGCCTTGG - Intronic
1173575673 20:44111766-44111788 CCAGCCCCCAAACTTGGCCTGGG + Exonic
1173849154 20:46207073-46207095 CCAGGCCCTGAGCCAGGCCTGGG - Intronic
1174095380 20:48084944-48084966 CCAGACCCGAAACTAGGCCTGGG - Intergenic
1174537380 20:51261810-51261832 CCAGGCCCAAAACCGGACCTAGG - Intergenic
1174945804 20:54984007-54984029 CCAGGCCTGAAACCAGGCCCGGG - Intergenic
1174957675 20:55117830-55117852 CCAGGGCCAAAACCAGGCCTGGG - Intergenic
1176374577 21:6080724-6080746 GCAGACCTAGAACCAGGCCTAGG + Intergenic
1177375940 21:20270994-20271016 CCAGGCCCAAAACCAGGCTTGGG + Intergenic
1177700990 21:24639019-24639041 CTAGGCCCAAAACCAGGCTTGGG + Intergenic
1178414247 21:32391204-32391226 CCCGACCCGACAACAGGCCCCGG - Intronic
1179134439 21:38667450-38667472 CAAGACTCAAACCCAGGCCTTGG + Intergenic
1179650872 21:42807776-42807798 CCAGACCTGAAACCAGGCCTGGG - Intergenic
1179668944 21:42932054-42932076 GCAGACCCGAAACCAGGCCTGGG + Intergenic
1179669574 21:42937172-42937194 GCAGACCCGAAACCAGGCCTGGG + Intergenic
1179748898 21:43457521-43457543 GCAGACCTAGAACCAGGCCTAGG - Intergenic
1181477282 22:23176578-23176600 TCAGACCCAACACCAGGCCGTGG - Intergenic
1183179530 22:36250344-36250366 CCAGGCCCGAAACCAGGCCTGGG + Intergenic
1183399228 22:37591782-37591804 CCAGACCTGAAACCAGGCCTGGG + Intergenic
1184012674 22:41760904-41760926 CCAGGCCCAAAACCAGGCCTGGG - Intronic
1184427755 22:44423212-44423234 CCAGGCCCTGCACCAGGCCTGGG - Intergenic
1184584882 22:45441185-45441207 CCAGACCCGAAACCAGGCCTGGG - Intergenic
1184989635 22:48158144-48158166 CCAAACCAGACAGCAGGCCTGGG - Intergenic
1185072206 22:48662544-48662566 GCAGAGCTGAACCCAGGCCTGGG + Intronic
949215348 3:1560743-1560765 CCAGACCAGAAATAAGGGCTGGG - Intergenic
949882576 3:8673574-8673596 CCAGACCCACAACCACACCTGGG + Intronic
949992357 3:9590276-9590298 CCAGACCCAAAACCAGGCCTGGG + Intergenic
950212188 3:11131928-11131950 CCAGGCCCAAAACCAGGCCTAGG + Intergenic
950970272 3:17179565-17179587 CCAGACCTGAATCTAGTCCTTGG - Intronic
952131037 3:30363702-30363724 CCAGACCCGAAACCAGGCCTAGG + Intergenic
952734446 3:36674864-36674886 CTAGGCCCGAAACCAGGCCTGGG + Intergenic
953008904 3:39005211-39005233 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
954495957 3:50962156-50962178 CCAGACCCCACAACAGGCCCTGG + Intronic
956462445 3:69485427-69485449 CCAGATCCGCACCCAGGACTTGG + Intronic
956995807 3:74825130-74825152 CCAGGCCTGAAACCAGGCCTGGG + Intergenic
957117241 3:76042659-76042681 CCAGACCCAAAACCAGGCCTGGG + Intronic
957289908 3:78266675-78266697 CCAGGCCCGAAACCAGGCCTGGG + Intergenic
958421601 3:93937705-93937727 CCAGGCCCAAAACTGGGCCTGGG - Intronic
958532869 3:95356936-95356958 CTAGGCCCAAAACCAGACCTGGG + Intergenic
958746227 3:98138359-98138381 CCAGACCCGAAACCAGGCCTGGG - Intergenic
958790156 3:98643080-98643102 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
959060644 3:101613278-101613300 CCAGGCCCAAAACCAGGCCTGGG - Intergenic
959294832 3:104522127-104522149 CCAGACCCGAAACCAGGCCTGGG + Intergenic
959711851 3:109393542-109393564 TCAGGCCCGAAACCAGGCCTGGG + Intergenic
959847874 3:111055380-111055402 TCAGACCCAACACCAGGCCGTGG - Intergenic
959970810 3:112407457-112407479 TCAGGCCCAAAACCAGGCCTGGG - Intergenic
960801951 3:121548772-121548794 CCACGCCCGAAACCAGGCCTGGG + Intergenic
961260382 3:125596839-125596861 CCAGGCCGGAAACCAGGCCTGGG + Intergenic
962769339 3:138597766-138597788 CCTGGCCCGAAACCAGGCCTGGG - Intergenic
963764432 3:149319622-149319644 CAAGAACAGAAACCAGGCCTAGG + Exonic
964373160 3:156022653-156022675 CCCGACCCCAAAACAGGCCCCGG - Intergenic
964982946 3:162709271-162709293 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
967659722 3:192091766-192091788 CCAGGCCCAAAACCAGGCCTGGG - Intergenic
968986928 4:3880605-3880627 CCCGCCCCGCCACCAGGCCTGGG + Intergenic
969729005 4:8942590-8942612 CCAGACCCACAACCACACCTGGG + Intergenic
969826222 4:9760666-9760688 CCAGACCCACAACCACACCTGGG + Intergenic
969852478 4:9970817-9970839 CCGGACCCAAAACCAGGCCTGGG + Intronic
971027091 4:22599352-22599374 CCAGGCCCGAAACCGGGCCTGGG + Intergenic
971027711 4:22605092-22605114 CCAGGCCCGAAACCGGGCCTGGG + Intergenic
971293965 4:25372846-25372868 CCAGACCCAAAACCAGGCCTGGG - Intergenic
971529187 4:27662771-27662793 TCAGACCCAATACCAGGCCGTGG - Intergenic
971752071 4:30663005-30663027 CCAGACCCGAAACCAGGCCTGGG - Intergenic
972076805 4:35100639-35100661 CCAGACCCAAAACCAGGCCTGGG + Intergenic
972077910 4:35108886-35108908 CCAGACCCAAAACCAGACCTGGG + Intergenic
972230942 4:37072104-37072126 CCAGAGCAGAACCCAGGACTAGG + Intergenic
972274698 4:37546295-37546317 CCAGGCCTAAAACCAGGACTGGG + Intronic
972275340 4:37552092-37552114 CCAGGCCCAAAACCAGACCTGGG + Intronic
974949458 4:68570426-68570448 CCAGGCCTGAAACCAGGCCTGGG - Intronic
974987750 4:69050965-69050987 CCAGGCCCAAAACCAGCCCTGGG + Intronic
974988329 4:69056964-69056986 CCATGCCCAAAACCAGCCCTGGG + Intronic
976235325 4:82890927-82890949 CCGGGCCCGAAACCAAGACTAGG + Intronic
976969584 4:91089352-91089374 CCAGACCCAAAACCAGGCCTGGG - Intronic
976989925 4:91353468-91353490 CCACGCCCAAAACCAGGCCTGGG - Intronic
976990537 4:91359308-91359330 CCAGGCCTGAAACCAGGCCTGGG - Intronic
977135709 4:93301014-93301036 TCAGGCCCGAAAACAGGCCTGGG - Intronic
979052262 4:115950485-115950507 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
979052857 4:115956155-115956177 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
980341056 4:131547798-131547820 CCAGGCCCAAAACTGGGCCTGGG + Intergenic
980571114 4:134621881-134621903 CCAGGCCCGAAACCAGGCCTGGG + Intergenic
982554068 4:156838848-156838870 TCAGACCCAACACCAGGCCATGG + Intronic
982663048 4:158229107-158229129 CCAGACCTGAAACCAGGCCTGGG - Intronic
983034883 4:162851566-162851588 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
983208636 4:164936182-164936204 CCAGGCCCAAAACCAGGCCTGGG - Intergenic
983449929 4:167896409-167896431 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
984184809 4:176531024-176531046 CCAGAGCTCAAACCAGGTCTTGG - Intergenic
984989702 4:185368323-185368345 GCAGAGCCGAGAGCAGGCCTGGG + Intronic
985051158 4:185993251-185993273 CCAGACACTAAACCAGTCCTGGG - Intergenic
987684728 5:21182516-21182538 TCAGACCCGACACCAGGTCATGG + Intergenic
987855900 5:23420436-23420458 CGAGGCCCAAAACCAGGCCTGGG - Intergenic
987876478 5:23687531-23687553 CCAGACCCAACACCAGGTCGTGG - Intergenic
987930242 5:24392148-24392170 CCAGATCCAAACCCAGGCCTGGG - Intergenic
987930872 5:24398055-24398077 CCAGACTCAAAACCAGGCCCGGG - Intergenic
988193189 5:27965048-27965070 CCAGACACAACACCAGGCCTTGG - Intergenic
988287589 5:29240232-29240254 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
989324374 5:40173818-40173840 CCAGACCAGAAACTAGGCCTGGG + Intergenic
989388020 5:40872436-40872458 CCAGACTCGAAACCAGGCCTGGG + Intergenic
989494823 5:42100344-42100366 TCAGACCCAACACCAGGCCATGG - Intergenic
989558003 5:42819437-42819459 CCAGGCCCAAAACCAGGCCTGGG + Intronic
989775846 5:45206227-45206249 CCAGGCCTGAAACCAAGCCTGGG + Intergenic
992018448 5:72598961-72598983 CCAGACCCAAAACCAGGCCTTGG - Intergenic
992292204 5:75291529-75291551 TCAGACCCAACACCAGGCCGTGG + Intergenic
992540347 5:77758258-77758280 CCAGGCCCAAAACCAGGCCTGGG + Intronic
992989902 5:82273616-82273638 CCAGGCCTGAAACCAGCCCTGGG - Exonic
995218143 5:109618606-109618628 CCAGTCCTGAACCCAAGCCTGGG + Intergenic
995867263 5:116704782-116704804 TCAGACCTGAAACCAGGCCTGGG + Intergenic
995867718 5:116709281-116709303 CCAGACCTGAAACCAGGCCTGGG + Intergenic
996128713 5:119755000-119755022 CCAGGCCCGAAACCAGGTCTGGG + Intergenic
996157959 5:120127024-120127046 CCCCACCCGAAAACAGGCCCTGG + Intergenic
997354720 5:133254930-133254952 CCAGAGCAGAGACCAGGCCTGGG - Intronic
998115109 5:139531194-139531216 CCAGGCCTGAAAGCAGGCCTGGG + Intronic
998451382 5:142236890-142236912 CCAGACCCGAAACCAGGCCTGGG - Intergenic
999517900 5:152319348-152319370 ACAGACCAGAAACCTGGTCTAGG - Intergenic
999754555 5:154654402-154654424 AATGACCCCAAACCAGGCCTGGG - Intergenic
1000604465 5:163313392-163313414 CCAGGCCTGAAACCAGGCCTGGG - Intergenic
1000605129 5:163319396-163319418 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1002407705 5:179048869-179048891 CCAGACCCAAAACCAGGCCTGGG - Intergenic
1002443411 5:179275739-179275761 CCTGACCCAAATCCAGGCATCGG - Intronic
1005472740 6:26177928-26177950 CCAGGCCTGAAACCAGGCCTGGG + Intergenic
1005562259 6:27052669-27052691 CCAGGCCCAAAACCAGGCCTGGG - Intergenic
1005586844 6:27285210-27285232 CCAGGCCCCAAACCAGACCTGGG + Intergenic
1006032381 6:31186643-31186665 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1006326150 6:33355555-33355577 TCAGACCCAACACCAGGCCGTGG - Intergenic
1006570374 6:34998470-34998492 CCAGACCCGAAACCAGGCCTGGG + Intronic
1006570954 6:35003942-35003964 CCAGACCTGAAACCAGGCCTGGG + Intronic
1007039819 6:38711323-38711345 TCAGACCCAACACCAGGCCGTGG - Intergenic
1009357270 6:62766294-62766316 CCAGGGCCGAAACAAGACCTGGG + Intergenic
1010317543 6:74468251-74468273 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
1010318158 6:74474240-74474262 CCACGCCCGAAACCAGGCCTGGG + Intergenic
1011179583 6:84604799-84604821 CCCCACCCCAAAACAGGCCTAGG - Intergenic
1011325559 6:86147305-86147327 TCAGACCCAACACCAGGCCATGG - Intergenic
1011368790 6:86610067-86610089 CCAGACCTGAAACCAGGCCTGGG - Intergenic
1013558881 6:111284523-111284545 CCAGGCCCAAAACCGGACCTGGG - Intergenic
1014035618 6:116764764-116764786 CCAGACCGCAATCCAGGCTTTGG - Intronic
1015049259 6:128819000-128819022 ACAGACCAGAAACCAGACCTGGG - Intergenic
1015171515 6:130260235-130260257 CCAGACCTGAAACCAGGCCTGGG + Intronic
1015172371 6:130267626-130267648 CCAGACCTAAAACCAGGCCTGGG + Intronic
1015217890 6:130770914-130770936 CCAGACCCGAAACCAGGCCTGGG - Intergenic
1017406921 6:154129382-154129404 CCAGGCCCGAAACCAGGCCTGGG - Intronic
1018066927 6:160131091-160131113 TCAGACCCCCAGCCAGGCCTGGG - Intronic
1018769542 6:166958631-166958653 CCAGGCCCAAAACCGGACCTGGG - Intergenic
1020311984 7:6875033-6875055 CCAGACCCACAACCACACCTGGG - Intergenic
1021081337 7:16369432-16369454 CCAGGCCCGAAACCAGGCCTGGG - Intronic
1022453399 7:30536536-30536558 TCAGACCCAACACCAGGTCTTGG - Intronic
1024212487 7:47217928-47217950 CCAGACCCCAAACCAGGCCTGGG - Intergenic
1026055095 7:66976819-66976841 CCATGCCCGAAACCACGCCTGGG - Intergenic
1027350278 7:77305006-77305028 CCAGGCCCAAAACCAGGCCCGGG - Intronic
1030259005 7:107543500-107543522 CCAGGCCCCAGACCAGCCCTCGG + Intronic
1030443826 7:109624356-109624378 CCAGACCCAACACCAGGTCGTGG + Intergenic
1031742679 7:125454746-125454768 CCAGGCCCGAAACCAGGCCTAGG + Intergenic
1032191246 7:129767172-129767194 CCAGGCCCCATACCAGGCCAAGG + Intergenic
1032979221 7:137262865-137262887 CCAGATCTGAAACCAGGCCTGGG - Intronic
1032979841 7:137268704-137268726 CCAGATCTGAAACCAGGCCTGGG - Intronic
1033223785 7:139545262-139545284 CCAGACACCACACCAGGCATGGG + Intergenic
1034091568 7:148368934-148368956 CCAGACCCGAAACCAGGCCTGGG - Intronic
1035280110 7:157773032-157773054 CCAGAACTGGATCCAGGCCTGGG + Intronic
1035741450 8:1930961-1930983 GCAGACCGGAATCCAGGCCGGGG - Intronic
1036833809 8:12041787-12041809 CCAGACCCACAACCACACCTGGG - Intergenic
1036855653 8:12288352-12288374 CCAGACCCACAACCACACCTGGG - Intergenic
1036903974 8:12692195-12692217 CCAGACCCACAACCACACCTGGG - Intergenic
1037588647 8:20295190-20295212 CCAGCCCCGGCACCATGCCTGGG + Intronic
1037894425 8:22642314-22642336 CCGGCCCCCAAAACAGGCCTGGG - Intronic
1039442410 8:37604419-37604441 ACAGACCCGACACCAAGGCTAGG + Intergenic
1040021075 8:42741866-42741888 CCAGGCCTGAAACTAGGCCTGGG - Intergenic
1040916625 8:52571820-52571842 CCAGACCCGAAACCAGGCCTGGG - Intergenic
1040992477 8:53367495-53367517 CCAGACCCGAAACCAGGCCTGGG - Intergenic
1041402751 8:57462434-57462456 CCAGACCCAAAACCAGGCCTGGG + Intergenic
1041671285 8:60494040-60494062 TCAGACCCAACACCAGGCCGTGG - Intergenic
1041728227 8:61038266-61038288 CCAGACCCTAAAACAGGACTGGG - Intergenic
1042355671 8:67824831-67824853 CCAGGCCCAAAACCAGACCTGGG + Intergenic
1042489343 8:69380609-69380631 CCAGACCCGAAACCAGGCCTGGG - Intergenic
1043749119 8:83912798-83912820 CCAGACCCAAAACCAGGTTGTGG - Intergenic
1044142746 8:88674984-88675006 CCAGGCCCGAAACCAGTCCTGGG + Intergenic
1044645689 8:94440940-94440962 CCAGGTCCAAAACCAGGCCTGGG + Intronic
1045799624 8:106087381-106087403 CCAGGCCCGAAAGCAGGCCTGGG - Intergenic
1045834117 8:106500286-106500308 CCAGGCCCGAAACCAGGCCTGGG + Intronic
1048291186 8:133182903-133182925 CCAGCCCCTGAACCATGCCTAGG - Intergenic
1048915511 8:139179051-139179073 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1049490376 8:142896167-142896189 CCAGAACCGAAACCAAGCCTGGG - Intronic
1049842150 8:144779562-144779584 TCAGACCCAACACCAGGCCATGG - Intronic
1051235878 9:14998251-14998273 CCACACCCCACACCAGGCCCCGG - Intergenic
1051248910 9:15139339-15139361 CCAGACCCGAAACCAGGCCTGGG + Intergenic
1051270781 9:15353227-15353249 CCAGACCCAAAACCAGGCCTGGG + Intergenic
1053020003 9:34688175-34688197 CCAGCAACAAAACCAGGCCTGGG - Intergenic
1053116190 9:35504884-35504906 CCAAACCCCACCCCAGGCCTTGG - Intronic
1053122951 9:35560036-35560058 CCAGACCCACTACCAGCCCTGGG + Exonic
1055506810 9:76956416-76956438 CCAGGCCCGAAACCAGGCCTGGG + Intergenic
1055609038 9:78002485-78002507 CCAGACACCAAACCAGCCCTTGG + Intronic
1056865361 9:90223861-90223883 CCAGACCCACAACCACACCTGGG + Intergenic
1056917648 9:90759026-90759048 CCAGACCCACAACCACACCTGGG - Intergenic
1060318930 9:122537353-122537375 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1060340842 9:122775720-122775742 CCAGGCCCGAAACCAGGCCTGGG + Intergenic
1062344103 9:136106973-136106995 CCAGGCCCCAACCCAGGCCCTGG + Intergenic
1185575905 X:1172047-1172069 CCAGGCCCGAAACCAGGCCTGGG + Intergenic
1185693842 X:2179141-2179163 CCAGGCCTGAAACCAGGCCTGGG + Intergenic
1185876376 X:3705439-3705461 CCAGTCCCAAAACCAAGTCTGGG - Intronic
1185895942 X:3859010-3859032 CCAGGCCTGAAACCAGGCCTGGG + Intergenic
1185901061 X:3897434-3897456 CCAGGCCTGAAACCAGGCCTGGG + Intergenic
1185906175 X:3935873-3935895 CCAGGCCTGAAACCAGGCCTGGG + Intergenic
1186013350 X:5163021-5163043 CCAGGCCCGAAACCAGGCCTGGG + Intergenic
1186558416 X:10585139-10585161 CCAGACCTGAAACCGGGCCTGGG - Intronic
1186558983 X:10590196-10590218 CCAGACCTGAAACCAGGCCTGGG - Intronic
1187491452 X:19755723-19755745 CCAGACCTGAAACTAGGCCTGGG + Intronic
1187841663 X:23495020-23495042 CCAGGCCCGAAACCAGGCCTGGG - Intergenic
1188877099 X:35443304-35443326 CCAGGCCCAAAACCAGGCCTGGG - Intergenic
1188897915 X:35693399-35693421 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
1191036693 X:56032070-56032092 CCAGACCCAAAACCAGGTCTGGG - Intergenic
1191741246 X:64437515-64437537 CCAGACCCAAATTCAGGCCTGGG - Intergenic
1192171895 X:68860873-68860895 CCAGAGTGGAAAACAGGCCTGGG - Intergenic
1192410056 X:70926080-70926102 CCAGACCCCAAATCGGGCCCAGG + Exonic
1193538810 X:82745868-82745890 CCAGGCCCGAAACCAGGCCTGGG + Intergenic
1194034003 X:88848445-88848467 CCAGACCCAACACCAGGTCATGG + Intergenic
1194503480 X:94705456-94705478 CCAGGCCCAAAACCAGGCCTGGG + Intergenic
1196252107 X:113473286-113473308 CCAGGCCCGAAACTAGGCCTGGG - Intergenic
1196861852 X:120036157-120036179 CCAGAACTGAAACCAGGCCTGGG - Intergenic
1197390529 X:125858081-125858103 CCAGACCCGAGACCAAGCTGAGG + Intergenic
1197390743 X:125860923-125860945 CCAGACCCGAGACCAAGCTGAGG + Intergenic
1198969394 X:142265258-142265280 CCAGACCCAAAACCAGGCCTGGG + Intergenic
1198970517 X:142273609-142273631 CCAGACCCAAAACCAGGCCTGGG + Intergenic
1199151364 X:144490581-144490603 CCAGACCCGAAACGAGGCCTGGG + Intergenic
1199162835 X:144634490-144634512 CCAGCCCCGAAACCAAGCCTGGG + Intergenic
1199377691 X:147133045-147133067 CCAGGCCCAAAACCAGGATTGGG + Intergenic
1199538891 X:148935645-148935667 CCAGACGGGAAATCAGGACTTGG + Intronic
1200744433 Y:6891206-6891228 CCAGACCCAAAACCAGGCCTGGG + Intergenic
1200789002 Y:7283272-7283294 CCAGACTCAAAACCAGGTTTGGG + Intergenic
1201270028 Y:12245598-12245620 CCAGACCTGAAACCAGGCCTGGG + Intergenic
1201270753 Y:12251630-12251652 GCAGAACGAAAACCAGGCCTGGG + Intergenic
1201346942 Y:12994887-12994909 CCAGGTCTGAAACCAGGACTGGG - Intergenic
1201372665 Y:13282402-13282424 CCAGGCCTGAAACCAGGCCTGGG + Intronic
1201373342 Y:13289347-13289369 CCAGGCCCGAAACCAGGCCTGGG + Intronic
1201390695 Y:13493977-13493999 CCAGGCCTGAAATCAGGCCTGGG - Intergenic
1201680103 Y:16636401-16636423 CCAGACCCAAAACGAGGCCTGGG - Intergenic
1201696337 Y:16831455-16831477 CCAGGCCCGAAACCAGGCCTGGG + Intergenic