ID: 1166244596

View in Genome Browser
Species Human (GRCh38)
Location 19:41516606-41516628
Sequence ACCAGACCCGAAACCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 30, 1: 48, 2: 67, 3: 87, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166244596_1166244602 2 Left 1166244596 19:41516606-41516628 CCAGGCCTGGTTTCGGGTCTGGT 0: 30
1: 48
2: 67
3: 87
4: 148
Right 1166244602 19:41516631-41516653 TGGATCTGGTGCCTGGCGCCGGG No data
1166244596_1166244601 1 Left 1166244596 19:41516606-41516628 CCAGGCCTGGTTTCGGGTCTGGT 0: 30
1: 48
2: 67
3: 87
4: 148
Right 1166244601 19:41516630-41516652 TTGGATCTGGTGCCTGGCGCCGG No data
1166244596_1166244604 16 Left 1166244596 19:41516606-41516628 CCAGGCCTGGTTTCGGGTCTGGT 0: 30
1: 48
2: 67
3: 87
4: 148
Right 1166244604 19:41516645-41516667 GGCGCCGGGCTGCCTGCCTTTGG 0: 5
1: 45
2: 103
3: 200
4: 350
1166244596_1166244600 -5 Left 1166244596 19:41516606-41516628 CCAGGCCTGGTTTCGGGTCTGGT 0: 30
1: 48
2: 67
3: 87
4: 148
Right 1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166244596 Original CRISPR ACCAGACCCGAAACCAGGCC TGG (reversed) Intergenic
901762376 1:11479399-11479421 CCCAGCCCCGAGACCAAGCCCGG - Intronic
904260238 1:29283790-29283812 ACCCCACCCGAAGGCAGGCCTGG - Intronic
904433940 1:30482121-30482143 ATCAGACCCAACACCAGGCCGGG - Intergenic
904475701 1:30763474-30763496 TCAAGACCAGAAACCAGGCTAGG - Intergenic
904558636 1:31382052-31382074 CCCAGGCCCCACACCAGGCCTGG - Intergenic
904573164 1:31483224-31483246 GCCAGGCCAAAAACCAGGCCTGG - Intergenic
906141358 1:43535624-43535646 GCCAGGCCTGAAACCTGGCCCGG - Intronic
906498927 1:46325902-46325924 GCCAGGCCCGAAACCAAGCCTGG - Intergenic
908401620 1:63776635-63776657 ACCAGACCCGAAACCAGGCCTGG - Intronic
908729847 1:67214849-67214871 ACCAGGCCCGAAACCAGGACTGG + Intronic
910614556 1:89182801-89182823 GCCAGGCCCAAAACCAGGCCTGG - Exonic
911909635 1:103616543-103616565 GCCAGGCCTGAAACCAGGCCTGG - Intergenic
915003850 1:152618844-152618866 ATCAGACCCAACACCAGGCTGGG + Intergenic
915347342 1:155204292-155204314 AAAAGACTCGAGACCAGGCCGGG + Intronic
916750624 1:167720287-167720309 ACCAGACCCGAAACCAGGCCTGG - Intergenic
916766199 1:167863180-167863202 ACCAGACCCGAAACCAGGCCTGG + Intronic
916766872 1:167869526-167869548 ACCAGACCCGAAACCAGGCCTGG + Intronic
917115623 1:171600549-171600571 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
917117297 1:171615528-171615550 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
918242412 1:182632468-182632490 ACCAGACCCGAAACCAGGCCTGG + Intergenic
919334706 1:196217363-196217385 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
919748708 1:201023755-201023777 GCCAGCCCCGAGCCCAGGCCGGG + Intergenic
920449947 1:206052625-206052647 GCCAGGCCCGAAACCAGGCCTGG + Intronic
920450593 1:206058537-206058559 GCCAGGCCCAAAACCAGGCCTGG + Intronic
920792695 1:209107764-209107786 ACCAGACCTGAAACCAGGCCTGG - Intergenic
921504554 1:215952157-215952179 AACAGACTTTAAACCAGGCCGGG - Intronic
921926876 1:220718127-220718149 ACCAGATCTGAAACCAGGCCTGG + Intergenic
922694115 1:227719297-227719319 ACCAGACCTGAAATGAGGCCTGG + Intergenic
922914460 1:229244740-229244762 GCCAGTCCCAAAACCAGGCCTGG - Intergenic
924819647 1:247476510-247476532 ATCAGACCCGAAACCAGGCCTGG - Intergenic
924833767 1:247628020-247628042 ATCAGACCTGAAACCAGCACAGG + Intergenic
1064397704 10:14994648-14994670 TCCAGACCCAAAACCACACCTGG - Intergenic
1065802010 10:29360788-29360810 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
1066367471 10:34791397-34791419 ACCAAGCCCGGGACCAGGCCGGG + Intronic
1066673734 10:37866083-37866105 ACCAGACCTGAAACCAGGCCTGG + Intergenic
1066976934 10:42377731-42377753 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
1068174416 10:53439320-53439342 ACCAGACCCAAAACCAGGCTTGG - Intergenic
1068996412 10:63210781-63210803 ACCAGAATAGAAAGCAGGCCTGG - Intronic
1069320088 10:67159018-67159040 GCCACGCCTGAAACCAGGCCTGG + Intronic
1069487531 10:68833711-68833733 ATCAGACCCGAAACCAGTCCTGG - Intronic
1069542878 10:69308633-69308655 ACCAGACCCGAAACCAGGCCTGG - Intronic
1069663524 10:70139558-70139580 AACAGACGCAAAACCAGGCACGG + Exonic
1070576530 10:77683113-77683135 GCCAGGCCCGAAACCTGGCTTGG + Intergenic
1071288134 10:84167539-84167561 GCCAGGCCTGAAACCAGGCCTGG - Intergenic
1071288639 10:84172340-84172362 GCCAGGCCTGAAACCAGGCCTGG - Intergenic
1072688774 10:97555814-97555836 GCCAGGCCCGAAACCACGCCTGG - Intronic
1072689384 10:97561679-97561701 GCCAGGCCCAAAACCAGACCTGG - Intronic
1072770418 10:98133192-98133214 ACCAGACCTGAAACCAGGCCTGG + Intergenic
1072832197 10:98670623-98670645 GCCAGGCCCAAAACCAGGCCTGG + Intronic
1075713821 10:124544554-124544576 ACCAGACCCGAATCCACCTCTGG + Intronic
1076720729 10:132391572-132391594 ACAACACCCGAACCCAGCCCAGG - Intergenic
1078245887 11:9573347-9573369 AGCCGACCCGAAAGCCGGCCTGG - Intergenic
1083136667 11:60684630-60684652 ACCAGACCCAAAACCAGGCCTGG - Intergenic
1083383323 11:62286828-62286850 GCCAGGCCTGAAACCAGGCCTGG - Intergenic
1083387932 11:62325893-62325915 GCCAGGCCCAAAACCAGTCCTGG + Intergenic
1083465187 11:62840887-62840909 ATCAAACGCGAAACCAGGCCGGG + Intronic
1083726577 11:64631481-64631503 ACCAAACCCTAAATCATGCCAGG + Intronic
1084167306 11:67381609-67381631 ACCTGACCTGGAACCAGGACAGG + Intronic
1085031158 11:73271657-73271679 ACCAGACCCGAAACCAGGCCTGG - Intronic
1085118819 11:73953678-73953700 GCCAGGCCTGAAACCAGGCCTGG - Intronic
1085180890 11:74535132-74535154 ACCAGACCCGAAACCAGGCCTGG - Intronic
1085240456 11:75049744-75049766 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
1085297923 11:75441357-75441379 ACCAGCCCCGACACTGGGCCTGG - Intronic
1085658309 11:78337913-78337935 AAAAGACCCGAGGCCAGGCCAGG + Intronic
1085998474 11:81951313-81951335 ACCAGACCCGAAATCAGGCCTGG + Intergenic
1086205196 11:84249786-84249808 ACCAGACCGGAAACAAGGTTAGG - Intronic
1086745613 11:90423063-90423085 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
1086759775 11:90613257-90613279 ACCAGACCCGAAACCAGGCCTGG - Intergenic
1086824696 11:91482049-91482071 GCCAGGCCTGAATCCAGGCCTGG - Intergenic
1088682577 11:112256529-112256551 CCCAGACCTAGAACCAGGCCAGG - Intronic
1091184864 11:133638033-133638055 ACCAGACACAAAAGCTGGCCAGG - Intergenic
1092326892 12:7542220-7542242 ACCAGACCTGAAATCAGGCCAGG + Intergenic
1092570234 12:9713469-9713491 ACCAGGCCCGAAACCAGGCCTGG - Intergenic
1093421788 12:18982413-18982435 ACCAGACCCGAAACCAGGCCTGG + Intergenic
1093885026 12:24449605-24449627 ATCAGACCCAAAACAGGGCCTGG + Intergenic
1096905313 12:54930304-54930326 ACCAGACCCAAAACCAGGCCTGG + Intergenic
1096996615 12:55842243-55842265 TCCTGACCCTAAACCATGCCAGG - Intronic
1098639152 12:72818662-72818684 GCCAGGCCCAAAACCAGGCCTGG - Intergenic
1098639755 12:72824672-72824694 GCCAGGCCCAAAACCAGGCCTGG - Intergenic
1098719458 12:73877643-73877665 GCCAGGCCTGAAACCAGGCCTGG - Intergenic
1102074535 12:110049255-110049277 GCCAGGCCCGAAACCAGGCCTGG + Intronic
1102259561 12:111435949-111435971 ACCAGACCCCACTCCAGGCCTGG - Intronic
1103954408 12:124568142-124568164 CCCAGACCCGAGACCCAGCCCGG + Intergenic
1104346499 12:128004453-128004475 ACCAGACCCAGAACCAGGCCTGG + Intergenic
1105695063 13:22880386-22880408 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
1105695397 13:22883654-22883676 CCCAGGTCTGAAACCAGGCCTGG + Intergenic
1105696004 13:22889474-22889496 GCCAGGCCCAAAACCAGGCCTGG + Intergenic
1106643662 13:31610488-31610510 GCCAGGCTCGAAACCAGGCCTGG - Intergenic
1106764907 13:32903872-32903894 GCCAAACCCGAAATCAGGGCTGG - Intergenic
1107997071 13:45871478-45871500 GCCAGGCCCAAAACCAGGCCTGG - Intergenic
1111119026 13:83822346-83822368 ACCAGACCAACAACCAGGACAGG + Intergenic
1112049766 13:95633789-95633811 ACGAGACATGAAACCAGGCTGGG + Intronic
1112678928 13:101739846-101739868 GCCAGGCCTGAAACCAGGCCTGG + Intronic
1113171168 13:107504914-107504936 CCCAGACCTGAAACCAGGCTTGG - Intronic
1114378493 14:22175136-22175158 GCCAGGCCCGAAACCAGGTCTGG + Intergenic
1114557320 14:23569603-23569625 ACCAAAGCCAGAACCAGGCCAGG + Exonic
1116047556 14:39763276-39763298 ACCAGACCTGAAACCAGGCCTGG - Intergenic
1116057067 14:39876816-39876838 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
1118409053 14:65457820-65457842 ACCAGGCCCAAAACCAGGCCTGG - Intronic
1118457377 14:65957231-65957253 ACCAGGCTCAAAACCAGGCCTGG - Intergenic
1120020966 14:79529389-79529411 GCCAGGCCCGAAACCAGGCCTGG - Intronic
1121384566 14:93508221-93508243 ACTAAACCCGAAAAAAGGCCAGG + Intronic
1121707870 14:96012976-96012998 GCCAGGCCCAAAACCAGGCCTGG + Intergenic
1122143970 14:99677876-99677898 CTCAGGCCCCAAACCAGGCCTGG + Exonic
1122482507 14:102056110-102056132 GCCAGGCCCAAAACCAGGCCTGG + Intergenic
1124392410 15:29271484-29271506 GCCAGGCCCAAAACCAGGCCTGG + Intronic
1124530559 15:30501882-30501904 ACCAGGCCCAAAACCAGGCCTGG - Intergenic
1124768100 15:32505816-32505838 ACCAGGCCCAAAACCAGGCCTGG + Intergenic
1125005572 15:34812974-34812996 ACCAGACCCGAAACCAGGCCTGG + Intergenic
1128202980 15:65825760-65825782 ACCAGACCCGAAACCAGGCCTGG + Intronic
1129167269 15:73785815-73785837 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
1129390729 15:75219568-75219590 GCCAGGCCCAAAGCCAGGCCTGG - Intergenic
1130955236 15:88622743-88622765 ACCAGACCCAAAACCAGGCCTGG - Intronic
1132123377 15:99197395-99197417 ATAAGAACAGAAACCAGGCCGGG - Intronic
1132178505 15:99733662-99733684 AACAGACGCGAAAACAAGCCAGG - Intergenic
1133366456 16:5214215-5214237 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
1133567148 16:7006608-7006630 ATAAAACCCGAAACCAAGCCAGG - Intronic
1133900962 16:9974274-9974296 ACCAGACCCGAAATCAGGCCTGG + Intronic
1136348101 16:29689640-29689662 ACCAGACCCGAAATCAGGCCTGG + Intronic
1136350982 16:29707593-29707615 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
1137499957 16:49003286-49003308 CCCAGCCCCGAAACCACTCCAGG - Intergenic
1138431880 16:56974061-56974083 ACCAGACCCGAAACCAGGCCTGG - Intronic
1138567823 16:57846286-57846308 TCCAGACCTAAAGCCAGGCCGGG + Intronic
1140415805 16:74773489-74773511 ACCAGTCCCAGAGCCAGGCCTGG + Intronic
1141091698 16:81134774-81134796 ACCAGACCTGAAACCAGGCCTGG + Intergenic
1141489584 16:84363146-84363168 ACCACACCCGCCACCACGCCCGG + Intergenic
1142435870 16:90056867-90056889 ACCAGACCCGAAACCAGGCCTGG - Intronic
1145227486 17:21142376-21142398 ACCAGACCGGAAACCAGGCCTGG - Intronic
1145789613 17:27618002-27618024 ACCAGCACTGATACCAGGCCAGG + Intronic
1145962242 17:28893689-28893711 GCCAGGCCCGAAACCAGGCCTGG + Intronic
1145967292 17:28928800-28928822 ACCAAACCAAAAAACAGGCCAGG + Intronic
1148196096 17:45714368-45714390 ACCAGACCCAAAATCAGAACTGG - Intergenic
1148486056 17:47991588-47991610 ACCCCACCCGGAAACAGGCCGGG - Intergenic
1148719980 17:49744721-49744743 ACAAGACAAGAAACCAGGCATGG + Intronic
1153705051 18:7736811-7736833 GCCAGGCCCGAAACCAGGCCTGG - Intronic
1155252401 18:23964977-23964999 GCCAGGCCCAAAACCAGGCCTGG + Intergenic
1157671438 18:49531993-49532015 ACCAGACCCGAAACCAAGCCTGG - Intergenic
1158863736 18:61617847-61617869 ACCAGACCCGAAACTAGGCCTGG + Intergenic
1159689827 18:71472608-71472630 GCCAGGCCCGAAACTAGGCCTGG - Intergenic
1160600301 18:80007541-80007563 GCCAGGCCCAAAACCAGGCCTGG - Intronic
1160864064 19:1249510-1249532 ACCAGACCCGTCTCCAGACCTGG + Intronic
1162220780 19:9174410-9174432 ATCAGACCTGGAATCAGGCCGGG - Intergenic
1162281544 19:9702191-9702213 ACCAGATCTGAAACCAGGCCTGG + Intergenic
1163067819 19:14812339-14812361 GCCAGGCCCAAAACCAGGCCTGG + Intronic
1163907706 19:20161535-20161557 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
1163934723 19:20432474-20432496 GCCAGGCCCAAAACCAGCCCTGG - Intergenic
1164669309 19:30063699-30063721 AACAGACCCTGACCCAGGCCTGG + Intergenic
1165764005 19:38338928-38338950 ATCAGACCCAACACCAGGTCGGG + Intronic
1166236950 19:41463786-41463808 ACCAGACCCGAAACCAGGCCTGG - Intergenic
1166244596 19:41516606-41516628 ACCAGACCCGAAACCAGGCCTGG - Intergenic
1167301559 19:48680687-48680709 AGCAGGCCCGGAACCAGTCCAGG - Intergenic
1167329432 19:48845717-48845739 TTCAGACCATAAACCAGGCCGGG + Intronic
1167581617 19:50347330-50347352 ACCAGACCCAAAACCAGGCCTGG - Intronic
1167915312 19:52735373-52735395 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
1167935076 19:52898878-52898900 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
1167935653 19:52904726-52904748 GCCAGGCCTGAAACCAGGCCTGG - Intergenic
1167938115 19:52923730-52923752 GCCACGCCCAAAACCAGGCCTGG + Intergenic
1168220815 19:54959053-54959075 ACCAGACCCGAAACCAGGCCTGG - Intronic
1168425197 19:56234544-56234566 GCCAGGCCCGAAACCAGGCCTGG + Intronic
928768540 2:34677287-34677309 GCCAGGCCCAAAACCAGGCCTGG + Intergenic
928904924 2:36357570-36357592 TCTAGACCCCAAACCAGACCAGG - Intronic
929857650 2:45650443-45650465 AGCAGACCACAAACCAAGCCGGG + Intergenic
930785894 2:55271114-55271136 GCCAGGCCCAAAACCAGGCCTGG + Intergenic
932744018 2:74316594-74316616 ACAAGACCTAAAGCCAGGCCAGG + Intronic
933279468 2:80317096-80317118 CCCAGACACTAAACCAGACCTGG + Intronic
934759293 2:96844625-96844647 CCCAGCCCCGAAGCCAAGCCTGG + Intronic
935330679 2:101975156-101975178 ACCAGACCCGAGAGCACACCTGG + Intergenic
935628035 2:105187162-105187184 AACAGGCCTGAAAACAGGCCAGG + Intergenic
937420538 2:121751256-121751278 ACCAAAACCAAAACAAGGCCAGG + Intronic
937887979 2:126913409-126913431 CCCAGCCCAGAAAACAGGCCTGG + Intergenic
940477169 2:154177798-154177820 ACCAGACCTGAAAAGAGACCTGG + Intronic
941854218 2:170213529-170213551 ACCAGACCCGAAACCAGGCCTGG - Intronic
947894462 2:233656576-233656598 ACAAGACCTCAAACCACGCCAGG - Intronic
948916617 2:241037622-241037644 CCCAGGTCCCAAACCAGGCCAGG + Intronic
1170009653 20:11708230-11708252 ACCAGGCCCAAAACCAGACCTGG + Intergenic
1170400733 20:15980222-15980244 ACCAGGCCCGAAACCAGGCCTGG - Intronic
1170401298 20:15986120-15986142 ACCAGCCCCGAAACCAGGCCTGG - Intronic
1172697311 20:36831596-36831618 ACCAGAAAGGAAACCAGGCATGG + Intronic
1173044589 20:39497493-39497515 ACCAAACCCAAATCAAGGCCAGG + Intergenic
1173139647 20:40470899-40470921 ACCAGACCCACAGGCAGGCCTGG + Intergenic
1173575671 20:44111765-44111787 ACCAGCCCCCAAACTTGGCCTGG + Exonic
1174095382 20:48084945-48084967 ACCAGACCCGAAACTAGGCCTGG - Intergenic
1174945806 20:54984008-54984030 GCCAGGCCTGAAACCAGGCCCGG - Intergenic
1174957677 20:55117831-55117853 GCCAGGGCCAAAACCAGGCCTGG - Intergenic
1177375938 21:20270993-20271015 GCCAGGCCCAAAACCAGGCTTGG + Intergenic
1177700989 21:24639018-24639040 ACTAGGCCCAAAACCAGGCTTGG + Intergenic
1179650874 21:42807777-42807799 ACCAGACCTGAAACCAGGCCTGG - Intergenic
1179668943 21:42932053-42932075 AGCAGACCCGAAACCAGGCCTGG + Intergenic
1179669573 21:42937171-42937193 AGCAGACCCGAAACCAGGCCTGG + Intergenic
1180698613 22:17769846-17769868 CCCAGTCCCAATACCAGGCCTGG + Intronic
1180962384 22:19767705-19767727 ATCTGTCCCGAAAACAGGCCAGG - Intronic
1183179528 22:36250343-36250365 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
1183379869 22:37485492-37485514 CCCAGACCCGTGCCCAGGCCAGG - Intronic
1183399226 22:37591781-37591803 ACCAGACCTGAAACCAGGCCTGG + Intergenic
1184012676 22:41760905-41760927 GCCAGGCCCAAAACCAGGCCTGG - Intronic
1184474575 22:44713526-44713548 ACAAAAACCAAAACCAGGCCAGG - Intronic
1184584884 22:45441186-45441208 ACCAGACCCGAAACCAGGCCTGG - Intergenic
949547040 3:5081322-5081344 ACAAGACCCGAGAGCAAGCCAGG - Intergenic
949992355 3:9590275-9590297 ACCAGACCCAAAACCAGGCCTGG + Intergenic
952734445 3:36674863-36674885 ACTAGGCCCGAAACCAGGCCTGG + Intergenic
953008906 3:39005212-39005234 GCCAGGCCTGAAACCAGGCCTGG - Intergenic
956995805 3:74825129-74825151 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
957117239 3:76042658-76042680 ACCAGACCCAAAACCAGGCCTGG + Intronic
957289906 3:78266674-78266696 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
958746229 3:98138360-98138382 ACCAGACCCGAAACCAGGCCTGG - Intergenic
958790158 3:98643081-98643103 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
959060646 3:101613279-101613301 GCCAGGCCCAAAACCAGGCCTGG - Intergenic
959294830 3:104522126-104522148 ACCAGACCCGAAACCAGGCCTGG + Intergenic
959711850 3:109393541-109393563 GTCAGGCCCGAAACCAGGCCTGG + Intergenic
959970811 3:112407458-112407480 GTCAGGCCCAAAACCAGGCCTGG - Intergenic
960801949 3:121548771-121548793 GCCACGCCCGAAACCAGGCCTGG + Intergenic
961260380 3:125596838-125596860 GCCAGGCCGGAAACCAGGCCTGG + Intergenic
962769341 3:138597767-138597789 GCCTGGCCCGAAACCAGGCCTGG - Intergenic
964982948 3:162709272-162709294 GCCAGGCCTGAAACCAGGCCTGG - Intergenic
967659724 3:192091767-192091789 GCCAGGCCCAAAACCAGGCCTGG - Intergenic
969852476 4:9970816-9970838 ACCGGACCCAAAACCAGGCCTGG + Intronic
971027089 4:22599351-22599373 GCCAGGCCCGAAACCGGGCCTGG + Intergenic
971027709 4:22605091-22605113 ACCAGGCCCGAAACCGGGCCTGG + Intergenic
971293967 4:25372847-25372869 ACCAGACCCAAAACCAGGCCTGG - Intergenic
971752073 4:30663006-30663028 ACCAGACCCGAAACCAGGCCTGG - Intergenic
972076803 4:35100638-35100660 ACCAGACCCAAAACCAGGCCTGG + Intergenic
972077908 4:35108885-35108907 ACCAGACCCAAAACCAGACCTGG + Intergenic
972275338 4:37552091-37552113 GCCAGGCCCAAAACCAGACCTGG + Intronic
972615147 4:40690964-40690986 ACCAGATGAGAAAGCAGGCCAGG - Intergenic
974615382 4:64272708-64272730 AACAGCCCGGAACCCAGGCCTGG - Intergenic
974949460 4:68570427-68570449 TCCAGGCCTGAAACCAGGCCTGG - Intronic
974987748 4:69050964-69050986 GCCAGGCCCAAAACCAGCCCTGG + Intronic
974988327 4:69056963-69056985 ACCATGCCCAAAACCAGCCCTGG + Intronic
976969586 4:91089353-91089375 ACCAGACCCAAAACCAGGCCTGG - Intronic
976989927 4:91353469-91353491 ACCACGCCCAAAACCAGGCCTGG - Intronic
976990539 4:91359309-91359331 GCCAGGCCTGAAACCAGGCCTGG - Intronic
977135710 4:93301015-93301037 GTCAGGCCCGAAAACAGGCCTGG - Intronic
979052260 4:115950484-115950506 GCCAGGCCCAAAACCAGGCCTGG + Intergenic
979052855 4:115956154-115956176 TCCAGGCCCAAAACCAGGCCTGG + Intergenic
980571112 4:134621880-134621902 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
982663050 4:158229108-158229130 ACCAGACCTGAAACCAGGCCTGG - Intronic
983034885 4:162851567-162851589 GCCAGGCCTGAAACCAGGCCTGG - Intergenic
983208638 4:164936183-164936205 GCCAGGCCCAAAACCAGGCCTGG - Intergenic
983449931 4:167896410-167896432 ACCAGGCCTGAAACCAGGCCTGG - Intergenic
983573169 4:169232025-169232047 ACCTAACCAGAAACCTGGCCTGG - Intronic
985051160 4:185993252-185993274 GCCAGACACTAAACCAGTCCTGG - Intergenic
985648241 5:1095189-1095211 GCCAGACCCCAAACCTGCCCAGG + Intronic
986015447 5:3753429-3753451 ACCAGCCCAGACACCAGGCTGGG + Intergenic
987855901 5:23420437-23420459 ACGAGGCCCAAAACCAGGCCTGG - Intergenic
987930244 5:24392149-24392171 ACCAGATCCAAACCCAGGCCTGG - Intergenic
987930874 5:24398056-24398078 ACCAGACTCAAAACCAGGCCCGG - Intergenic
988287591 5:29240233-29240255 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
989324372 5:40173817-40173839 ACCAGACCAGAAACTAGGCCTGG + Intergenic
989388018 5:40872435-40872457 ACCAGACTCGAAACCAGGCCTGG + Intergenic
989558001 5:42819436-42819458 GCCAGGCCCAAAACCAGGCCTGG + Intronic
989775844 5:45206226-45206248 GCCAGGCCTGAAACCAAGCCTGG + Intergenic
992540345 5:77758257-77758279 ACCAGGCCCAAAACCAGGCCTGG + Intronic
992989904 5:82273617-82273639 ACCAGGCCTGAAACCAGCCCTGG - Exonic
993998516 5:94750958-94750980 TCCAGAACCGAAACCTGGGCAGG + Intronic
995218141 5:109618605-109618627 ACCAGTCCTGAACCCAAGCCTGG + Intergenic
995867262 5:116704781-116704803 ATCAGACCTGAAACCAGGCCTGG + Intergenic
995867716 5:116709280-116709302 ACCAGACCTGAAACCAGGCCTGG + Intergenic
996128711 5:119754999-119755021 GCCAGGCCCGAAACCAGGTCTGG + Intergenic
997354722 5:133254931-133254953 ACCAGAGCAGAGACCAGGCCTGG - Intronic
997479816 5:134176727-134176749 ACCGGGCCCGAAAGAAGGCCAGG + Intronic
997525225 5:134548725-134548747 TCCAGACCCAGAACCAGGCCTGG - Intronic
998115107 5:139531193-139531215 ACCAGGCCTGAAAGCAGGCCTGG + Intronic
998177793 5:139912412-139912434 ACCAGTACCCAGACCAGGCCAGG - Intronic
998451384 5:142236891-142236913 ACCAGACCCGAAACCAGGCCTGG - Intergenic
999754556 5:154654403-154654425 AAATGACCCCAAACCAGGCCTGG - Intergenic
1000460999 5:161517949-161517971 ACCACACCCGCCACCACGCCCGG + Intronic
1000604467 5:163313393-163313415 GCCAGGCCTGAAACCAGGCCTGG - Intergenic
1000605131 5:163319397-163319419 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
1002407707 5:179048870-179048892 ACCAGACCCAAAACCAGGCCTGG - Intergenic
1002542511 5:179915525-179915547 ACCCGCCCAGGAACCAGGCCTGG + Intronic
1003954121 6:11146431-11146453 ACCAGCCTAGAAAACAGGCCGGG - Intergenic
1005472738 6:26177927-26177949 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
1005562261 6:27052670-27052692 GCCAGGCCCAAAACCAGGCCTGG - Intergenic
1005586842 6:27285209-27285231 GCCAGGCCCCAAACCAGACCTGG + Intergenic
1006032383 6:31186644-31186666 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
1006570372 6:34998469-34998491 ACCAGACCCGAAACCAGGCCTGG + Intronic
1006570952 6:35003941-35003963 ACCAGACCTGAAACCAGGCCTGG + Intronic
1010317541 6:74468250-74468272 GCCAGGCCCAAAACCAGGCCTGG + Intergenic
1010318156 6:74474239-74474261 GCCACGCCCGAAACCAGGCCTGG + Intergenic
1011313960 6:86010869-86010891 AAAACACCTGAAACCAGGCCAGG + Intergenic
1011314089 6:86011898-86011920 AAAACACCTGAAACCAGGCCAGG - Intergenic
1011368792 6:86610068-86610090 ACCAGACCTGAAACCAGGCCTGG - Intergenic
1013168656 6:107616710-107616732 ATCAGACCCGAATCCACGCTCGG - Intronic
1015049260 6:128819001-128819023 AACAGACCAGAAACCAGACCTGG - Intergenic
1015171513 6:130260234-130260256 ACCAGACCTGAAACCAGGCCTGG + Intronic
1015172369 6:130267625-130267647 ACCAGACCTAAAACCAGGCCTGG + Intronic
1015217892 6:130770915-130770937 ACCAGACCCGAAACCAGGCCTGG - Intergenic
1016850489 6:148613983-148614005 AACAGATCAGAAACCACGCCTGG + Intergenic
1017406923 6:154129383-154129405 GCCAGGCCCGAAACCAGGCCTGG - Intronic
1018800230 6:167216562-167216584 ACTGGACCCGAGGCCAGGCCGGG - Intergenic
1018812869 6:167309944-167309966 ACTGGACCCGAGGCCAGGCCGGG + Intronic
1019293265 7:260817-260839 ACCAGTCCTGGAACCAGGCATGG + Intergenic
1021081339 7:16369433-16369455 GCCAGGCCCGAAACCAGGCCTGG - Intronic
1022539223 7:31120995-31121017 GCCAGACCCAAACTCAGGCCTGG - Intergenic
1022962823 7:35446086-35446108 GCCAGACCTGAATCCAGGCAGGG - Intergenic
1024100888 7:46031499-46031521 ACTAGACCAGAAACCAGCCTGGG - Intergenic
1024212489 7:47217929-47217951 ACCAGACCCCAAACCAGGCCTGG - Intergenic
1024218983 7:47273250-47273272 ACCAGAACACACACCAGGCCAGG - Intergenic
1025164579 7:56701636-56701658 ACAAGACCCAACACCATGCCTGG + Intergenic
1026055097 7:66976820-66976842 GCCATGCCCGAAACCACGCCTGG - Intergenic
1026966973 7:74446268-74446290 CCCAGACCAGCAGCCAGGCCTGG - Intergenic
1026981751 7:74530858-74530880 ACCAGGCCTGATACCAGCCCAGG + Intronic
1027350280 7:77305007-77305029 GCCAGGCCCAAAACCAGGCCCGG - Intronic
1032979223 7:137262866-137262888 ACCAGATCTGAAACCAGGCCTGG - Intronic
1032979843 7:137268705-137268727 ACCAGATCTGAAACCAGGCCTGG - Intronic
1033281725 7:140010629-140010651 ACCAGCACTGAAACCAGGGCAGG - Intronic
1034091570 7:148368935-148368957 ACCAGACCCGAAACCAGGCCTGG - Intronic
1035471597 7:159113161-159113183 ACCAGACCCGACACCAGGCCTGG + Intronic
1035741451 8:1930962-1930984 TGCAGACCGGAATCCAGGCCGGG - Intronic
1038778185 8:30549565-30549587 ACCAAACAGGAAACCAGGCCAGG - Intronic
1039466571 8:37789060-37789082 ACCAGATGGGAAGCCAGGCCTGG + Intronic
1040021077 8:42741867-42741889 GCCAGGCCTGAAACTAGGCCTGG - Intergenic
1040916627 8:52571821-52571843 ACCAGACCCGAAACCAGGCCTGG - Intergenic
1040992479 8:53367496-53367518 ACCAGACCCGAAACCAGGCCTGG - Intergenic
1040993752 8:53379672-53379694 ACCATACCCAAAACCAGGCCTGG - Intergenic
1041402749 8:57462433-57462455 ACCAGACCCAAAACCAGGCCTGG + Intergenic
1041728229 8:61038267-61038289 CCCAGACCCTAAAACAGGACTGG - Intergenic
1042355669 8:67824830-67824852 GCCAGGCCCAAAACCAGACCTGG + Intergenic
1042489345 8:69380610-69380632 ACCAGACCCGAAACCAGGCCTGG - Intergenic
1044142744 8:88674983-88675005 ACCAGGCCCGAAACCAGTCCTGG + Intergenic
1044645687 8:94440939-94440961 GCCAGGTCCAAAACCAGGCCTGG + Intronic
1045799626 8:106087382-106087404 GCCAGGCCCGAAAGCAGGCCTGG - Intergenic
1045834115 8:106500285-106500307 GCCAGGCCCGAAACCAGGCCTGG + Intronic
1048035214 8:130671482-130671504 ACCAGAAGCCAAAACAGGCCAGG + Intergenic
1048915513 8:139179052-139179074 GCCAGGCCCGAAACCAGGCCTGG - Intergenic
1049005031 8:139849412-139849434 ACCAGAACAGAAACCAGAACAGG + Intronic
1049259048 8:141629135-141629157 CCCAGACCCGCACCAAGGCCAGG - Intergenic
1049490378 8:142896168-142896190 ACCAGAACCGAAACCAAGCCTGG - Intronic
1051248908 9:15139338-15139360 ACCAGACCCGAAACCAGGCCTGG + Intergenic
1051270779 9:15353226-15353248 ACCAGACCCAAAACCAGGCCTGG + Intergenic
1052661861 9:31443812-31443834 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
1053867253 9:42452939-42452961 CCAAGACTCAAAACCAGGCCGGG + Intergenic
1055506808 9:76956415-76956437 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
1056101217 9:83302170-83302192 ACCAGATCCCAAACCTGGCCGGG + Intronic
1056992016 9:91421547-91421569 ACCAGACCCGCCCCCAGCCCCGG + Intronic
1057019890 9:91689016-91689038 ATCAGACCTGAGTCCAGGCCAGG + Intronic
1057027545 9:91746375-91746397 ACGTGAGCAGAAACCAGGCCAGG - Intronic
1057942391 9:99296567-99296589 ACCCTCCCCGGAACCAGGCCCGG + Intergenic
1060318932 9:122537354-122537376 ACCAGGCCCGAAACCAGGCCTGG - Intergenic
1060340840 9:122775719-122775741 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
1060823643 9:126675185-126675207 AATACACCCAAAACCAGGCCGGG + Intronic
1061901913 9:133677426-133677448 ACCAGAGCAGATACCTGGCCAGG + Intronic
1062170258 9:135130968-135130990 ACAAGAGCCAGAACCAGGCCAGG - Intergenic
1185575903 X:1172046-1172068 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
1185693840 X:2179140-2179162 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
1185895940 X:3859009-3859031 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
1185901059 X:3897433-3897455 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
1185906173 X:3935872-3935894 GCCAGGCCTGAAACCAGGCCTGG + Intergenic
1186013348 X:5163020-5163042 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
1186558418 X:10585140-10585162 ACCAGACCTGAAACCGGGCCTGG - Intronic
1186558985 X:10590197-10590219 ACCAGACCTGAAACCAGGCCTGG - Intronic
1187417316 X:19104391-19104413 ACCAGATCCCAAAACAGCCCGGG + Intronic
1187491450 X:19755722-19755744 ACCAGACCTGAAACTAGGCCTGG + Intronic
1187841665 X:23495021-23495043 ACCAGGCCCGAAACCAGGCCTGG - Intergenic
1188877101 X:35443305-35443327 GCCAGGCCCAAAACCAGGCCTGG - Intergenic
1188897913 X:35693398-35693420 GCCAGGCCCAAAACCAGGCCTGG + Intergenic
1191036695 X:56032071-56032093 ACCAGACCCAAAACCAGGTCTGG - Intergenic
1191741248 X:64437516-64437538 ACCAGACCCAAATTCAGGCCTGG - Intergenic
1192171897 X:68860874-68860896 ACCAGAGTGGAAAACAGGCCTGG - Intergenic
1193349767 X:80448499-80448521 ACCAAAACAGAAACCATGCCAGG + Intergenic
1193538808 X:82745867-82745889 GCCAGGCCCGAAACCAGGCCTGG + Intergenic
1194281628 X:91960717-91960739 ATAAGACCTGAAACCTGGCCAGG - Intronic
1194503478 X:94705455-94705477 GCCAGGCCCAAAACCAGGCCTGG + Intergenic
1196252109 X:113473287-113473309 ACCAGGCCCGAAACTAGGCCTGG - Intergenic
1196836719 X:119820444-119820466 ACCACACCCAAAAAAAGGCCGGG - Intergenic
1196861854 X:120036158-120036180 ACCAGAACTGAAACCAGGCCTGG - Intergenic
1198969392 X:142265257-142265279 ACCAGACCCAAAACCAGGCCTGG + Intergenic
1198970515 X:142273608-142273630 ACCAGACCCAAAACCAGGCCTGG + Intergenic
1199151362 X:144490580-144490602 ACCAGACCCGAAACGAGGCCTGG + Intergenic
1199162833 X:144634489-144634511 GCCAGCCCCGAAACCAAGCCTGG + Intergenic
1199377689 X:147133044-147133066 ACCAGGCCCAAAACCAGGATTGG + Intergenic
1200599222 Y:5185372-5185394 ATAAGACCTGAAACCTGGCCAGG - Intronic
1200744431 Y:6891205-6891227 ACCAGACCCAAAACCAGGCCTGG + Intergenic
1201270026 Y:12245597-12245619 ACCAGACCTGAAACCAGGCCTGG + Intergenic
1201270752 Y:12251629-12251651 AGCAGAACGAAAACCAGGCCTGG + Intergenic
1201372663 Y:13282401-13282423 ACCAGGCCTGAAACCAGGCCTGG + Intronic
1201373340 Y:13289346-13289368 GCCAGGCCCGAAACCAGGCCTGG + Intronic
1201390697 Y:13493978-13494000 GCCAGGCCTGAAATCAGGCCTGG - Intergenic
1201680105 Y:16636402-16636424 ACCAGACCCAAAACGAGGCCTGG - Intergenic
1201696335 Y:16831454-16831476 GCCAGGCCCGAAACCAGGCCTGG + Intergenic