ID: 1166244597

View in Genome Browser
Species Human (GRCh38)
Location 19:41516611-41516633
Sequence CCAAAACCAGACCCGAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 4, 1: 13, 2: 4, 3: 17, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166244597_1166244602 -3 Left 1166244597 19:41516611-41516633 CCTGGTTTCGGGTCTGGTTTTGG 0: 4
1: 13
2: 4
3: 17
4: 164
Right 1166244602 19:41516631-41516653 TGGATCTGGTGCCTGGCGCCGGG No data
1166244597_1166244604 11 Left 1166244597 19:41516611-41516633 CCTGGTTTCGGGTCTGGTTTTGG 0: 4
1: 13
2: 4
3: 17
4: 164
Right 1166244604 19:41516645-41516667 GGCGCCGGGCTGCCTGCCTTTGG 0: 5
1: 45
2: 103
3: 200
4: 350
1166244597_1166244601 -4 Left 1166244597 19:41516611-41516633 CCTGGTTTCGGGTCTGGTTTTGG 0: 4
1: 13
2: 4
3: 17
4: 164
Right 1166244601 19:41516630-41516652 TTGGATCTGGTGCCTGGCGCCGG No data
1166244597_1166244600 -10 Left 1166244597 19:41516611-41516633 CCTGGTTTCGGGTCTGGTTTTGG 0: 4
1: 13
2: 4
3: 17
4: 164
Right 1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166244597 Original CRISPR CCAAAACCAGACCCGAAACC AGG (reversed) Intergenic
900525692 1:3127556-3127578 CCAAAATGAAACCAGAAACCAGG - Intronic
902221387 1:14967992-14968014 CCAAAACCATCCCCCAACCCCGG - Intronic
902280181 1:15368642-15368664 TCAAAGCCAGACCCTAGACCAGG + Intronic
904155523 1:28479699-28479721 ACATAACGAAACCCGAAACCCGG + Intronic
904728528 1:32569359-32569381 GGAAAACCAGACCACAAACCAGG - Intronic
908401621 1:63776640-63776662 AAGGAACCAGACCCGAAACCAGG - Intronic
908729846 1:67214844-67214866 CCAGCACCAGGCCCGAAACCAGG + Intronic
911025940 1:93435421-93435443 CCAAAATCAGACCAGGCACCAGG + Intergenic
916750625 1:167720292-167720314 TAAGAACCAGACCCGAAACCAGG - Intergenic
916766198 1:167863175-167863197 TAGGAACCAGACCCGAAACCAGG + Intronic
916766871 1:167869521-167869543 TAAGAACCAGACCCGAAACCAGG + Intronic
918242411 1:182632463-182632485 TAGGAACCAGACCCGAAACCAGG + Intergenic
920792696 1:209107769-209107791 TGAAAACCAGACCTGAAACCAGG - Intergenic
924819648 1:247476515-247476537 CCAAAATCAGACCCGAAACCAGG - Intergenic
1066673733 10:37866078-37866100 CCAAAACCAGACCTGAAACCAGG + Intergenic
1067474879 10:46558348-46558370 CCAGATCCAGGCCCCAAACCTGG + Intergenic
1069107502 10:64401298-64401320 GCAGAACCAGACCGGAACCCAGG - Intergenic
1069542879 10:69308638-69308660 AAGGAACCAGACCCGAAACCAGG - Intronic
1069751509 10:70748218-70748240 CCAGACCCAGTCCCGAATCCAGG - Intronic
1072770417 10:98133187-98133209 CCAAAACCAGACCTGAAACCAGG + Intergenic
1075512378 10:123083060-123083082 CCCAAGCCAGACCCCAGACCAGG + Intergenic
1077148521 11:1056768-1056790 CCAAGACCAGAACTGAGACCAGG + Intergenic
1082200897 11:49365604-49365626 CCAAAACCATTCCAGAAACTTGG - Intergenic
1083136668 11:60684635-60684657 CCAAAACCAGACCCAAAACCAGG - Intergenic
1084499319 11:69525460-69525482 CCACAACCAGACCCTGAAGCAGG - Intergenic
1084801291 11:71545885-71545907 CCAACTGCAGACCCAAAACCAGG - Intronic
1085031159 11:73271662-73271684 AAGGAACCAGACCCGAAACCAGG - Intronic
1085180891 11:74535137-74535159 TAGGAACCAGACCCGAAACCAGG - Intronic
1086654775 11:89340624-89340646 CCAAAACCATTCCAGAAACTTGG + Intronic
1086759776 11:90613262-90613284 AGGGAACCAGACCCGAAACCAGG - Intergenic
1088358928 11:108970985-108971007 ACAAAACCAAACCCGGAAACAGG + Intergenic
1089015897 11:115165022-115165044 CCAAAACAAAACCCCAAAGCCGG + Intergenic
1090372720 11:126268132-126268154 CCAAACCCAGGGCCCAAACCTGG - Intronic
1092211108 12:6647051-6647073 CCAAAACCCGCTCCGAGACCAGG + Intronic
1092526159 12:9311484-9311506 CCACGAGCAGACCCGAGACCTGG + Intergenic
1092541118 12:9420299-9420321 CCACGAGCAGACCCGAGACCTGG - Intergenic
1092570235 12:9713474-9713496 CCAGCACCAGGCCCGAAACCAGG - Intergenic
1093216312 12:16365967-16365989 CAAAGACCTGACCCAAAACCAGG - Intronic
1093421787 12:18982408-18982430 GAGGAACCAGACCCGAAACCAGG + Intergenic
1103131373 12:118471514-118471536 CCAAAACCCACCCTGAAACCTGG + Intergenic
1103664060 12:122547575-122547597 ACAAAACCAGACAAGATACCTGG - Intronic
1103839444 12:123850659-123850681 CCAAACTCAGACCTGAACCCAGG - Intronic
1104346498 12:128004448-128004470 CCAAAACCAGACCCAGAACCAGG + Intergenic
1104687784 12:130800020-130800042 GCCAAAACAGATCCGAAACCAGG + Intronic
1105695062 13:22880381-22880403 CCAGCGCCAGGCCCGAAACCAGG + Intergenic
1107337201 13:39367963-39367985 CCAAAACATGACCCCAAATCAGG + Intronic
1108713876 13:53059925-53059947 CCAAAACCAGACCAAAAGCAAGG - Intergenic
1109478757 13:62919731-62919753 CCAAAATCAGAGCAGACACCAGG + Intergenic
1111902736 13:94219724-94219746 CCGAAACGAGACCCCAAATCAGG - Intronic
1113601771 13:111574470-111574492 CCTCAACCAGACCAGAAACGTGG + Intergenic
1114684215 14:24512989-24513011 CCAAAACCATACCTGCATCCTGG - Intergenic
1119671925 14:76526532-76526554 CCAAGTCCAGACCCCACACCTGG - Intergenic
1120264545 14:82232522-82232544 ACAAAACCAGTCCTGGAACCAGG - Intergenic
1121901595 14:97697972-97697994 CCAAAACAAGAAGAGAAACCAGG - Intergenic
1122918360 14:104869117-104869139 CCAAACTCAGACCTCAAACCAGG - Intronic
1123112751 14:105880801-105880823 CCAAATCCAGAGCCGACACCAGG - Intergenic
1124931255 15:34121812-34121834 TAGGAACCAGACCCGAAACCAGG + Intergenic
1125005571 15:34812969-34812991 TAGGAACCAGACCCGAAACCAGG + Intergenic
1127248948 15:57209318-57209340 CCAAAACCAAAACAGAAAGCAGG + Intronic
1128146500 15:65334957-65334979 CAAACACCAGCCCAGAAACCAGG + Intronic
1128202979 15:65825755-65825777 TAGGAACCAGACCCGAAACCAGG + Intronic
1130955237 15:88622748-88622770 CCAAAACCAGACCCAAAACCAGG - Intronic
1132971418 16:2691118-2691140 CCACAGCGAGACCCGAACCCTGG + Intronic
1133954054 16:10424289-10424311 CCATAAACAGACCCCAAAACTGG - Intronic
1134029651 16:10981713-10981735 ACAAAACTAGAACAGAAACCCGG - Intronic
1138431881 16:56974066-56974088 AAGGAACCAGACCCGAAACCAGG - Intronic
1139282603 16:65783635-65783657 CCAGAACCTGACACCAAACCTGG - Intergenic
1139644803 16:68320668-68320690 CCAAAAACAGGCCCCAAAACTGG - Intronic
1139783105 16:69368018-69368040 CCAAAACCAGTTCCTAAAGCAGG - Intronic
1140471871 16:75219977-75219999 CCAAAACCAAAACCAAAAACAGG - Intronic
1142435871 16:90056872-90056894 AAGGAACCAGACCCGAAACCAGG - Intronic
1144218527 17:13079350-13079372 CCCAAACCAGACCCAGAAGCTGG + Intergenic
1145962241 17:28893684-28893706 CCAGCGCCAGGCCCGAAACCAGG + Intronic
1147132415 17:38417400-38417422 CCAACACCAGACCCTAGGCCTGG + Intergenic
1147614981 17:41822312-41822334 CCAGAACCAGGACCGCAACCAGG + Exonic
1148885050 17:50766306-50766328 CCAGAACCTGACCTGAAACGAGG + Intergenic
1149930591 17:60750786-60750808 ACAAAAGCAGACCTGAAAGCAGG - Intronic
1153293783 18:3526389-3526411 CCGTAACCAAACCTGAAACCAGG + Intronic
1153705052 18:7736816-7736838 CCAGCGCCAGGCCCGAAACCAGG - Intronic
1155305405 18:24473315-24473337 CCAAAACAAGACCACAAACTGGG + Intronic
1157249015 18:46077891-46077913 CCTAACCCAGACCCCAACCCTGG + Intergenic
1157576865 18:48749437-48749459 CCAAAATCAGAACAGAAGCCAGG + Intronic
1160126470 18:76177176-76177198 ACAAGACCAGACCAGCAACCAGG - Intergenic
1161502702 19:4625760-4625782 CTAAAACCAAAACCAAAACCAGG - Intergenic
1161532540 19:4798749-4798771 CCAAAACAACACCAGAAAGCAGG - Exonic
1163294565 19:16404046-16404068 CCTAACCCAGGCCCGACACCTGG + Intronic
1163958390 19:20664860-20664882 ACAAAACCAGACACAAAACCAGG - Intronic
1166225169 19:41390577-41390599 GCAAAGCCAGGCCCGAAACTTGG + Intronic
1166236951 19:41463791-41463813 CCAAAACCAGACCCGAAACCAGG - Intergenic
1166244597 19:41516611-41516633 CCAAAACCAGACCCGAAACCAGG - Intergenic
1167166268 19:47802337-47802359 CCAAACCCAGGCCCGATCCCAGG - Exonic
1167166304 19:47802445-47802467 CCAAACCCAGGCCCGATCCCAGG - Exonic
1167166314 19:47802469-47802491 CCAAACCCAGGCCCGATCCCAGG - Exonic
1167581618 19:50347335-50347357 CCAAAACCAGACCCAAAACCAGG - Intronic
1167910047 19:52694429-52694451 CTAAAACCAGACCTGAAACCAGG + Intergenic
1168220816 19:54959058-54959080 CCAAAACCAGACCCGAAACCAGG - Intronic
931255743 2:60570515-60570537 CAAAAACCAGACCCGGATCACGG - Intergenic
932618186 2:73249374-73249396 CCAAAACAAGTCCAGAAATCTGG + Intronic
935095526 2:99940868-99940890 CCAAAACCAGAACTAGAACCAGG + Intronic
935200953 2:100856129-100856151 CCAAAACCAGAACAGAAAAATGG + Intronic
935414434 2:102800769-102800791 CCAAAACCAGAACGAAAACCAGG - Intronic
935594560 2:104868693-104868715 CCCAAACCAGACCCGCCAGCTGG - Intergenic
935685264 2:105677494-105677516 CCAAGAGCAGACCCTCAACCAGG + Intergenic
939468366 2:142586968-142586990 CCAAAACCAGACCCAAAACCAGG - Intergenic
941854219 2:170213534-170213556 TAGGAACCAGACCCGAAACCAGG - Intronic
944586561 2:201178615-201178637 CCATAAACTGACCCGAAAACTGG - Intergenic
947853606 2:233308041-233308063 CCAAAACCTTATCAGAAACCTGG + Intronic
948536596 2:238651611-238651633 CCAAAAACAGACCCCAAAAATGG - Intergenic
1169994439 20:11541120-11541142 CCATAACCAGTCGCTAAACCAGG - Intergenic
1170400734 20:15980227-15980249 CCTGCACCAGGCCCGAAACCAGG - Intronic
1170401299 20:15986125-15986147 CCGGCACCAGCCCCGAAACCAGG - Intronic
1171381012 20:24734232-24734254 CTAAAACCAAACCCCAGACCTGG - Intergenic
1171459798 20:25292106-25292128 CCAAAACCTTCCCCAAAACCAGG - Intronic
1173666537 20:44767171-44767193 CCAGAACCAGACCTGAGACATGG - Intronic
1174095383 20:48084950-48084972 AAAGAACCAGACCCGAAACTAGG - Intergenic
1178459590 21:32790605-32790627 CCTAAACCAGACCCCAAAGAGGG + Intergenic
1178669517 21:34578575-34578597 CCAAGACCAGAGCAGACACCAGG - Intronic
1179553999 21:42160779-42160801 CCAAAAGGAGACCTGAAAACGGG - Intergenic
1183007879 22:34918481-34918503 CCACAACCATACCCGCCACCCGG - Intergenic
1183661320 22:39223201-39223223 CCAAGACCAGACCGCAGACCCGG + Intergenic
1184584885 22:45441191-45441213 TAGGAACCAGACCCGAAACCAGG - Intergenic
950303591 3:11901638-11901660 GCAAAACCTGCCCCGAAAGCCGG - Intergenic
952131035 3:30363696-30363718 TAGGAACCAGACCCGAAACCAGG + Intergenic
952721025 3:36532741-36532763 CAAAAAGCAGACCCCAAAACAGG - Intronic
954150047 3:48652781-48652803 CCAAGACCAGGCCCCAAATCTGG + Intronic
957117238 3:76042653-76042675 CCAAAACCAGACCCAAAACCAGG + Intronic
957410604 3:79834843-79834865 ACAAAACCAAACCCCAAAACTGG - Intergenic
957613359 3:82497871-82497893 CCAAGACCAGCCCCGAGACCTGG + Intergenic
958422943 3:93949238-93949260 TTGAAGCCAGACCCGAAACCTGG + Intronic
958746230 3:98138365-98138387 TAGGAACCAGACCCGAAACCAGG - Intergenic
958790159 3:98643086-98643108 CCAGCGCCAGGCCCGAAACCAGG - Intergenic
958833797 3:99120273-99120295 CCACTAGCAGACCCAAAACCTGG - Intergenic
958926398 3:100162324-100162346 GCAAAATCAGAACCAAAACCAGG + Exonic
959294829 3:104522121-104522143 CCAAAACCAGACCCGAAACCAGG + Intergenic
968821777 4:2858691-2858713 CCAAAACCACACCCAAGGCCAGG + Intronic
969250093 4:5961980-5962002 CCAAAACCAGCCCAGATACATGG + Intronic
969852475 4:9970811-9970833 CCAAAACCGGACCCAAAACCAGG + Intronic
971027708 4:22605086-22605108 CCGGCACCAGGCCCGAAACCGGG + Intergenic
971340609 4:25765376-25765398 CCAAAACCAGTCACAAGACCTGG - Exonic
971752074 4:30663011-30663033 TAGGAACCAGACCCGAAACCAGG - Intergenic
972076802 4:35100633-35100655 CCAAAACCAGACCCAAAACCAGG + Intergenic
974444347 4:61960335-61960357 CAAAAACAAGACCCTGAACCAGG + Intronic
974875819 4:67701269-67701291 CCACACCCAAACCGGAAACCAGG - Intergenic
979199334 4:117958144-117958166 CCAGAACCAGACCCTAAGACAGG - Intergenic
982957630 4:161792131-161792153 CCAAAACCAGAGCAGACACCAGG - Intronic
987181460 5:15372636-15372658 CCAAAATCAGACCAGGCACCAGG - Intergenic
989251385 5:39319658-39319680 CCAAAATCAGGCGCGAGACCAGG + Intronic
991095032 5:62730978-62731000 CCAAAACCATACCCCACCCCAGG - Intergenic
991279503 5:64895884-64895906 CCAAAAACAGATTGGAAACCTGG + Intronic
992018450 5:72598967-72598989 CCAAAACCAGACCCAAAACCAGG - Intergenic
996739057 5:126782454-126782476 GCAAAACCTGACCTGAAACCAGG - Intronic
998451385 5:142236896-142236918 AAGGAACCAGACCCGAAACCAGG - Intergenic
999330940 5:150672845-150672867 ACAAACCCAGACCTGAATCCCGG - Intronic
999517901 5:152319354-152319376 CCTGAAACAGACCAGAAACCTGG - Intergenic
999949135 5:156629824-156629846 TCAAAACCAGAGCCTAGACCAGG - Intronic
1001942119 5:175748124-175748146 CCAAAACTATACCCAAAATCTGG + Intergenic
1004066731 6:12253805-12253827 CCAAAGCCAGGCCAAAAACCTGG + Intergenic
1005327661 6:24719192-24719214 CCAAAACCAAACACCAAAACAGG + Exonic
1006570371 6:34998464-34998486 AAGGAACCAGACCCGAAACCAGG + Intronic
1007052232 6:38844010-38844032 ACAAAACCAGCCCCACAACCAGG - Intronic
1007539703 6:42629898-42629920 CCAAAACCAAAACAAAAACCAGG - Intronic
1013299084 6:108786370-108786392 CTACAACCAGACCCGACAGCAGG - Intergenic
1015217893 6:130770920-130770942 CAGGAACCAGACCCGAAACCAGG - Intergenic
1017329252 6:153176644-153176666 CCAAAACCAAACCATAAATCAGG + Intergenic
1022902753 7:34826795-34826817 TCAAAACCAGCCCAGAAACCTGG - Intronic
1023168242 7:37364112-37364134 CCAACACCATACCCCATACCTGG + Intronic
1024024488 7:45399408-45399430 CCAAAATCAGAGCGGGAACCGGG - Intergenic
1024212490 7:47217934-47217956 CCAAAACCAGACCCCAAACCAGG - Intergenic
1024270937 7:47641026-47641048 CCAAAACCAGGCCATAAGCCAGG - Intergenic
1024315202 7:48009681-48009703 CCAAACCAAGACAAGAAACCAGG + Intronic
1026511707 7:71032957-71032979 CCAAAAGCAGACACCAAAACAGG + Intergenic
1031742677 7:125454740-125454762 CCAGTGCCAGGCCCGAAACCAGG + Intergenic
1034091571 7:148368940-148368962 TAGGAACCAGACCCGAAACCAGG - Intronic
1040916628 8:52571826-52571848 TAGGAACCAGACCCGAAACCAGG - Intergenic
1040992480 8:53367501-53367523 AAGGAACCAGACCCGAAACCAGG - Intergenic
1041924645 8:63224075-63224097 CCAGATCCAGACCCGAAAAGAGG + Intergenic
1042489346 8:69380615-69380637 AAGGAACCAGACCCGAAACCAGG - Intergenic
1043961396 8:86422845-86422867 CCAAAACCAGAACCAAAATTAGG + Intronic
1048915514 8:139179057-139179079 CCAGTGCCAGGCCCGAAACCAGG - Intergenic
1050386758 9:5099019-5099041 CCAACACCAGACTTAAAACCAGG + Intronic
1050530139 9:6581437-6581459 CCAAAATCAGACCCTGAAACAGG - Intronic
1050576183 9:6998029-6998051 AGAAAATCAGACCCAAAACCAGG - Intronic
1051248907 9:15139333-15139355 TAAGAACCAGACCCGAAACCAGG + Intergenic
1051607187 9:18927528-18927550 CCAAAACAAGACTCCAGACCAGG + Intergenic
1052661860 9:31443807-31443829 CCAGAGCCAGGCCTGAAACCAGG + Intergenic
1053176072 9:35925112-35925134 CCAAAACCAGAACCCAAAGGTGG + Intergenic
1055506807 9:76956410-76956432 CCAGCGCCAGGCCCGAAACCAGG + Intergenic
1056067711 9:82954071-82954093 CCTCAACCAGGCCAGAAACCTGG - Intergenic
1060964939 9:127707154-127707176 CCACATCCAGATCCGAGACCTGG + Exonic
1062429435 9:136520436-136520458 CCAAAACCAGACCCCAGCCCTGG + Intronic
1191035720 X:56024793-56024815 CCAAACCCAGTCCCAAAACCAGG - Intergenic
1191036696 X:56032076-56032098 CCAAAACCAGACCCAAAACCAGG - Intergenic
1196324559 X:114388288-114388310 CCAACACCACACCCCAAGCCTGG + Intergenic
1196861855 X:120036163-120036185 CCAAAACCAGAACTGAAACCAGG - Intergenic
1198970514 X:142273603-142273625 CCAAAACCAGACCCAAAACCAGG + Intergenic
1199377688 X:147133039-147133061 CCAGCACCAGGCCCAAAACCAGG + Intergenic
1201270025 Y:12245592-12245614 AAAGAACCAGACCTGAAACCAGG + Intergenic
1201355073 Y:13088673-13088695 CCTAAGCAAGACCCTAAACCTGG + Intergenic
1201680106 Y:16636407-16636429 CGAAAACCAGACCCAAAACGAGG - Intergenic
1201696334 Y:16831449-16831471 CCAGTGCCAGGCCCGAAACCAGG + Intergenic
1202073565 Y:21016689-21016711 CCAAAATCAGAGCAGACACCAGG + Intergenic
1202078265 Y:21058543-21058565 CCAAAATCAGAGCAGACACCAGG + Intergenic