ID: 1166244600

View in Genome Browser
Species Human (GRCh38)
Location 19:41516624-41516646
Sequence CTGGTTTTGGATCTGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166244596_1166244600 -5 Left 1166244596 19:41516606-41516628 CCAGGCCTGGTTTCGGGTCTGGT 0: 30
1: 48
2: 67
3: 87
4: 148
Right 1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG No data
1166244597_1166244600 -10 Left 1166244597 19:41516611-41516633 CCTGGTTTCGGGTCTGGTTTTGG 0: 4
1: 13
2: 4
3: 17
4: 164
Right 1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG No data
1166244594_1166244600 -4 Left 1166244594 19:41516605-41516627 CCCAGGCCTGGTTTCGGGTCTGG 0: 31
1: 84
2: 94
3: 57
4: 224
Right 1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166244600 Original CRISPR CTGGTTTTGGATCTGGTGCC TGG Intergenic
No off target data available for this crispr