ID: 1166244826

View in Genome Browser
Species Human (GRCh38)
Location 19:41517928-41517950
Sequence GTGGACACACCCTGCGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166244819_1166244826 9 Left 1166244819 19:41517896-41517918 CCATTGGATATTAGGAACAATAT 0: 32
1: 333
2: 792
3: 1378
4: 1933
Right 1166244826 19:41517928-41517950 GTGGACACACCCTGCGATATTGG No data
1166244817_1166244826 17 Left 1166244817 19:41517888-41517910 CCTCTTTTCCATTGGATATTAGG No data
Right 1166244826 19:41517928-41517950 GTGGACACACCCTGCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166244826 Original CRISPR GTGGACACACCCTGCGATAT TGG Intergenic
No off target data available for this crispr