ID: 1166245532

View in Genome Browser
Species Human (GRCh38)
Location 19:41522950-41522972
Sequence GTGTACACACCCTGCGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166245527_1166245532 9 Left 1166245527 19:41522918-41522940 CCCTCTAAATATTAGGAACAATA No data
Right 1166245532 19:41522950-41522972 GTGTACACACCCTGCGATATTGG No data
1166245528_1166245532 8 Left 1166245528 19:41522919-41522941 CCTCTAAATATTAGGAACAATAT 0: 25
1: 83
2: 463
3: 991
4: 1587
Right 1166245532 19:41522950-41522972 GTGTACACACCCTGCGATATTGG No data
1166245525_1166245532 16 Left 1166245525 19:41522911-41522933 CCTCTGTCCCTCTAAATATTAGG No data
Right 1166245532 19:41522950-41522972 GTGTACACACCCTGCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166245532 Original CRISPR GTGTACACACCCTGCGATAT TGG Intergenic
No off target data available for this crispr