ID: 1166245698

View in Genome Browser
Species Human (GRCh38)
Location 19:41524051-41524073
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166245693_1166245698 13 Left 1166245693 19:41524015-41524037 CCTCGCTTGGATATTAGAAACAA No data
Right 1166245698 19:41524051-41524073 GTGTACACCCACTGCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166245698 Original CRISPR GTGTACACCCACTGCGATAT TGG Intergenic
No off target data available for this crispr