ID: 1166246493

View in Genome Browser
Species Human (GRCh38)
Location 19:41530835-41530857
Sequence GAAATAAGCAGAACATCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166246493_1166246500 25 Left 1166246493 19:41530835-41530857 CCAGCTGATGTTCTGCTTATTTC No data
Right 1166246500 19:41530883-41530905 CAAACCACAATCACAGTTGTTGG No data
1166246493_1166246495 -4 Left 1166246493 19:41530835-41530857 CCAGCTGATGTTCTGCTTATTTC No data
Right 1166246495 19:41530854-41530876 TTTCGCATACCGGAACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166246493 Original CRISPR GAAATAAGCAGAACATCAGC TGG (reversed) Intergenic
No off target data available for this crispr